Rmu_sc0002722.1_g000012

Belongs to the peptidase M16 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002722.1
Physical Location & Seq
Forward (+)
58539 .. 59121
583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002722.1_g000012.1.cds

Sequence Viewer

Length: 288 bp
atgaggattgatgttgtatcaaagccctcatttaagtcagaagatttccagtgcgaaccttggtttgggtcactttatactgaggaagatgtatctccatctttgatagatttgtggaaggaccatccagaaattgatgtttcattgcatctcccagaaaagaatgagttcattcctactgatttttccatttgttctgatggtcttgatactacagatacagcttctccaagatgtatattggatgagccattggtgaaattctggtacaaacttgatagtacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000166 GO:0003674 GO:0003824 GO:0004175 GO:0004222 GO:0005102 GO:0005488 GO:0005515 GO:0005524 GO:0005575 GO:0005576 GO:0005615 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005739 GO:0005777 GO:0005782 GO:0005829 GO:0006508 GO:0006518 GO:0006605 GO:0006625 GO:0006807 GO:0006810 GO:0006886 GO:0006996 GO:0007031 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007169 GO:0007275 GO:0007568 GO:0008104 GO:0008144 GO:0008150 GO:0008152 GO:0008233 GO:0008237 GO:0008270 GO:0008286 GO:0008340 GO:0009056 GO:0009057 GO:0009719 GO:0009725 GO:0009893 GO:0009894 GO:0009896 GO:0009986 GO:0009987 GO:0010033 GO:0010243 GO:0010259 GO:0010604 GO:0010815 GO:0010992 GO:0015031 GO:0015833 GO:0016043 GO:0016787 GO:0017046 GO:0017076 GO:0017144 GO:0019222 GO:0019538 GO:0019725 GO:0022607 GO:0023052 GO:0030163 GO:0030554 GO:0031334 GO:0031907 GO:0031974 GO:0032459 GO:0032461 GO:0032501 GO:0032502 GO:0032553 GO:0032555 GO:0032559 GO:0032868 GO:0032869 GO:0032870 GO:0033036 GO:0033218 GO:0033365 GO:0034613 GO:0034641 GO:0035639 GO:0036094 GO:0042176 GO:0042221 GO:0042277 GO:0042562 GO:0042579 GO:0042592 GO:0042737 GO:0042802 GO:0042803 GO:0042886 GO:0043167 GO:0043168 GO:0043169 GO:0043170 GO:0043171 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043254 GO:0043434 GO:0043559 GO:0043574 GO:0043603 GO:0043933 GO:0044085 GO:0044087 GO:0044089 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044421 GO:0044422 GO:0044424 GO:0044438 GO:0044439 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0045732 GO:0046872 GO:0046907 GO:0046914 GO:0046983 GO:0048518 GO:0048522 GO:0048856 GO:0050435 GO:0050789 GO:0050794 GO:0050896 GO:0051128 GO:0051130 GO:0051171 GO:0051173 GO:0051179 GO:0051234 GO:0051246 GO:0051247 GO:0051259 GO:0051260 GO:0051603 GO:0051641 GO:0051649 GO:0051716 GO:0060255 GO:0065003 GO:0065007 GO:0065008 GO:0070011 GO:0070013 GO:0070727 GO:0070887 GO:0071310 GO:0071375 GO:0071417 GO:0071495 GO:0071702 GO:0071704 GO:0071705 GO:0071840 GO:0072594 GO:0072662 GO:0072663 GO:0080090 GO:0097159 GO:0097242 GO:0097367 GO:0140030 GO:0140035 GO:0140036 GO:0140096 GO:1901142 GO:1901143 GO:1901265 GO:1901363 GO:1901564 GO:1901565 GO:1901575 GO:1901652 GO:1901653 GO:1901698 GO:1901699 GO:1901700 GO:1901701
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

95

Amino Acids

10.96

Weight (kDa)

4.22

Isoelectric Point (pI)

40.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019850)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 260
AfaI GTAC 2 cut(s) 269, 283
AfiI CCNNNNNNNGG 1 cut(s) 65
AjuI GAANNNNNNNTTGG 2 cut(s) 48, 80
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
ApoI RAATTY 1 cut(s) 260
Asp700I GAANNNNTTC 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 1 cut(s) 268
AvaII GGWCC 1 cut(s) 121
BccI CCATC 3 cut(s) 106, 132, 194
BfmI CTRYAG 1 cut(s) 213
BmcAI AGTACT 1 cut(s) 283
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmsI GCATC 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 211, 241
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 49
Bse3DI GCAATG 1 cut(s) 143
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 2 cut(s) 124, 250
BseLI CCNNNNNNNGG 1 cut(s) 65
BseMI GCAATG 1 cut(s) 143
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 143
BsrI ACTGG 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 59
BssT1I CCWWGG 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 2 cut(s) 124, 250
BstSFI CTRYAG 1 cut(s) 213
BtsCI GGATG 2 cut(s) 124, 250
BtsIMutI CAGTG 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 121
Csp6I GTAC 2 cut(s) 268, 282
CviJI RGCY 3 cut(s) 25, 224, 250
CviKI_1 RGCY 3 cut(s) 25, 224, 250
CviQI GTAC 2 cut(s) 268, 282
DdeI CTNAG 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaiI YATR 2 cut(s) 78, 239
FokI GGATG 2 cut(s) 111, 257
HphI GGTGA 1 cut(s) 268
Hpy188I TCNGA 2 cut(s) 40, 199
Hpy188III TCNNGA 2 cut(s) 128, 206
HpyAV CCTTC 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 81
LpnPI CCDG 4 cut(s) 62, 141, 168, 250
LweI GCATC 1 cut(s) 157
MaeIII GTNAC 1 cut(s) 69
MboII GAAGA 2 cut(s) 53, 98
MluCI AATT 2 cut(s) 132, 260
MnlI CCTC 2 cut(s) 37, 76
MroXI GAANNNNTTC 1 cut(s) 167
MseI TTAA 1 cut(s) 33
NmuCI GTSAC 1 cut(s) 69
PdmI GAANNNNTTC 1 cut(s) 167
PspPI GGNCC 1 cut(s) 121
RsaI GTAC 2 cut(s) 269, 283
RsaNI GTAC 2 cut(s) 268, 282
SaqAI TTAA 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 121
ScaI AGTACT 1 cut(s) 283
SetI ASST 2 cut(s) 61, 226
SfaNI GCATC 1 cut(s) 157
SfcI CTRYAG 1 cut(s) 213
SgeI CNNG 7 cut(s) 61, 72, 140, 167, 218, 243, 277
SinI GGWCC 1 cut(s) 121
Sse9I AATT 2 cut(s) 132, 260
StyI CCWWGG 1 cut(s) 59
TasI AATT 2 cut(s) 132, 260
TatI WGTACW 1 cut(s) 281
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TscAI CASTG 1 cut(s) 56
TseFI GTSAC 1 cut(s) 69
Tsp45I GTSAC 1 cut(s) 69
TspDTI ATGAA 2 cut(s) 132, 160
TspRI CASTG 1 cut(s) 56
VpaK11BI GGWCC 1 cut(s) 121
XapI RAATTY 1 cut(s) 260
XmnI GAANNNNTTC 1 cut(s) 167
ZrmI AGTACT 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.