Rmu_sc0002968.1_g000032

Belongs to the Frigida family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002968.1
OG0019890
Physical Location & Seq
Forward (+)
149598 .. 150778
1181 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002968.1_g000032.1.cds

Sequence Viewer

Length: 1080 bp
atggggacgaatgtggtttcttccattgtcaagattgagcgatcagaatcttcgctagccagaaatgaagcagctctttctcctcgaaataaatatttacagaatgaaaggattgtttctcttccttctattgtcaagactgagggacccaaatattttggggctagatctgcagcaactatatcttcaccaaataatgctgagggaccagaatctttgctggctagaaatgaagcaactccttctcctccgaataaatatttacagaatgaaaggattgtctctcttccttccattgccaagactgggggacccaaatcttttggggctagatttgcagtaactctttcttcaccaaataatgctgagggaccagaatctttgctggctagaaatgaagcaactccttctcctccgaataaatatttacagaatgaaaggattgtctctcttccttccattgccaagactgggggacccaaatcttttggggctagatttgcagtaactctttcttcaccaaataatgctgagggaccagaatctttgctggctagaaatgaagcaactccttctcctccgaataaatatttacagaatgaaaggattgtctctcttccttccattgccaagactgggggacccaaatcttttggggctagatttgcagaaaatctgttggtcactcttaaatcatcatcagaccctgcaaaacttgtgttggattcgatgcaagggtctcttacgtattactggagaaatagagatgttagttccaaagaaaaggttgtatctggtaacattactctattgaagattctaatgggactgtcaacacatgttggacctcatctgaaagaaaatgcaacaaatctagcatcccagtggaaagaaaagttgagagctgatactgaagattcatcggagagtttgggatatttgctgtttatagctatgtatggattgcttggaaccttacgtgaagatgagattgtaatgcttcttagaagggtttcgcagcataaacagtctctagagttatgtcagacacatggttttgcagattatatccctggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Frigida

Protein Analysis

359

Amino Acids

38.85

Weight (kDa)

9.46

Isoelectric Point (pI)

52.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019890)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0124191
rosa_multiflora Rmu_sc0002968.1_g000032
rosa_roxburghii Rroxscaffold_3G00224230
rosa_rugosa Rorug07G0303100
rosa_samantha Rh2BG317300 Rh2CG295200 Rh7DG447100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 933
AfiI CCNNNNNNNGG 3 cut(s) 306, 471, 636
AflIII ACRYGT 1 cut(s) 838
AgsI TTSAA 1 cut(s) 814
AjnI CCWGG 1 cut(s) 1072
AluBI AGCT 3 cut(s) 74, 905, 953
AluI AGCT 3 cut(s) 74, 905, 953
Alw26I GTCTC 5 cut(s) 286, 451, 616, 744, 1035
AlwNI CAGNNNCTG 1 cut(s) 707
ApeKI GCWGC 3 cut(s) 71, 173, 1018
Asp700I GAANNNNTTC 1 cut(s) 1012
AspS9I GGNCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
AsuHPI GGTGA 3 cut(s) 180, 345, 510
AsuNHI GCTAGC 1 cut(s) 55
AvaII GGWCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
BbvCI CCTCAGC 3 cut(s) 201, 366, 531
BbvI GCAGC 3 cut(s) 83, 185, 1030
BciT130I CCWGG 1 cut(s) 1074
BcoDI GTCTC 5 cut(s) 286, 451, 616, 744, 1035
BfmI CTRYAG 1 cut(s) 171
BglII AGATCT 1 cut(s) 167
BisI GCNGC 3 cut(s) 72, 174, 1019
BlsI GCNGC 3 cut(s) 73, 175, 1020
Bme1390I CCNGG 1 cut(s) 1074
Bme18I GGWCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
BmgT120I GGNCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
BmrFI CCNGG 1 cut(s) 1074
BmrI ACTGGG 4 cut(s) 315, 480, 645, 877
BmsI GCATC 2 cut(s) 720, 887
BmtI GCTAGC 1 cut(s) 59
BmuI ACTGGG 4 cut(s) 315, 480, 645, 877
BpmI CTGGAG 1 cut(s) 775
Bpu10I CCTNAGC 3 cut(s) 201, 366, 531
BsaAI YACGTR 2 cut(s) 747, 980
BsaBI GATNNNNATC 1 cut(s) 46
BsaI GGTCTC 1 cut(s) 744
BsaJI CCNNGG 1 cut(s) 1072
BsaXI ACNNNNNCTCC 6 cut(s) 229, 259, 394, 424, 559, 589
Bsc4I CCNNNNNNNGG 3 cut(s) 306, 471, 636
Bse1I ACTGG 5 cut(s) 310, 475, 640, 758, 883
Bse3DI GCAATG 3 cut(s) 294, 459, 624
Bse8I GATNNNNATC 1 cut(s) 46
BseBI CCWGG 1 cut(s) 1074
BseDI CCNNGG 1 cut(s) 1072
BseGI GGATG 1 cut(s) 878
BseJI GATNNNNATC 1 cut(s) 46
BseLI CCNNNNNNNGG 3 cut(s) 306, 471, 636
BseMI GCAATG 3 cut(s) 294, 459, 624
BseMII CTCAG 4 cut(s) 132, 192, 357, 522
BseNI ACTGG 5 cut(s) 310, 475, 640, 758, 883
BseRI GAGGAG 4 cut(s) 72, 237, 402, 567
BseXI GCAGC 3 cut(s) 83, 185, 1030
BslFI GGGAC 9 cut(s) 19, 159, 219, 324, 384, 489, 549, 654, 840
BslI CCNNNNNNNGG 3 cut(s) 306, 471, 636
BsmAI GTCTC 5 cut(s) 286, 451, 616, 744, 1035
BsmFI GGGAC 9 cut(s) 19, 159, 219, 324, 384, 489, 549, 654, 840
Bso31I GGTCTC 1 cut(s) 744
Bsp143I GATC 2 cut(s) 41, 167
BspCNI CTCAG 4 cut(s) 133, 193, 358, 523
BspMAI CTGCAG 1 cut(s) 175
BspOI GCTAGC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 744
BsrDI GCAATG 3 cut(s) 294, 459, 624
BsrI ACTGG 5 cut(s) 310, 475, 640, 758, 883
BssECI CCNNGG 1 cut(s) 1072
BssMI GATC 2 cut(s) 41, 167
Bst2UI CCWGG 1 cut(s) 1074
Bst4CI ACNGT 2 cut(s) 831, 1029
Bst6I CTCTTC 4 cut(s) 126, 291, 456, 621
BstBAI YACGTR 2 cut(s) 747, 980
BstC8I GCNNGC 4 cut(s) 57, 222, 387, 552
BstDEI CTNAG 5 cut(s) 141, 201, 366, 531, 1004
BstF5I GGATG 1 cut(s) 878
BstKTI GATC 2 cut(s) 44, 170
BstMAI GTCTC 5 cut(s) 286, 451, 616, 744, 1035
BstMBI GATC 2 cut(s) 41, 167
BstMWI GCNNNNNNNGC 4 cut(s) 170, 335, 500, 665
BstNI CCWGG 1 cut(s) 1074
BstNSI RCATGY 1 cut(s) 842
BstSCI CCNGG 1 cut(s) 1072
BstSFI CTRYAG 1 cut(s) 171
BstSNI TACGTA 1 cut(s) 747
BstV1I GCAGC 3 cut(s) 83, 185, 1030
BstX2I RGATCY 1 cut(s) 167
BstYI RGATCY 1 cut(s) 167
BtsCI GGATG 1 cut(s) 878
BtsIMutI CAGTG 1 cut(s) 890
Cac8I GCNNGC 4 cut(s) 57, 222, 387, 552
CaiI CAGNNNCTG 1 cut(s) 707
Cfr13I GGNCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
CviAII CATG 2 cut(s) 839, 1052
DdeI CTNAG 5 cut(s) 141, 201, 366, 531, 1004
DpnI GATC 2 cut(s) 43, 169
DpnII GATC 2 cut(s) 41, 167
Eam1104I CTCTTC 4 cut(s) 126, 291, 456, 621
EarI CTCTTC 4 cut(s) 126, 291, 456, 621
Eco105I TACGTA 1 cut(s) 747
Eco31I GGTCTC 1 cut(s) 744
Eco47I GGWCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
Eco57I CTGAAG 1 cut(s) 933
EcoO109I RGGNCCY 4 cut(s) 146, 311, 476, 641
EcoRII CCWGG 1 cut(s) 1072
FaeI CATG 2 cut(s) 842, 1055
FaiI YATR 9 cut(s) 182, 840, 950, 956, 960, 1023, 1042, 1053, 1068
FalI AAGNNNNNCTT 4 cut(s) 60, 92, 726, 758
FaqI GGGAC 9 cut(s) 19, 159, 219, 324, 384, 489, 549, 654, 840
FatI CATG 2 cut(s) 838, 1051
Fnu4HI GCNGC 3 cut(s) 72, 174, 1019
FokI GGATG 1 cut(s) 865
Fsp4HI GCNGC 3 cut(s) 72, 174, 1019
GluI GCNGC 3 cut(s) 72, 174, 1019
GsuI CTGGAG 1 cut(s) 775
Hin1II CATG 2 cut(s) 842, 1055
HincII GTYRAC 1 cut(s) 834
HindII GTYRAC 1 cut(s) 834
HinfI GANTC 7 cut(s) 47, 212, 377, 542, 725, 817, 917
HphI GGTGA 3 cut(s) 180, 345, 510
Hpy166II GTNNAC 1 cut(s) 834
Hpy188I TCNGA 8 cut(s) 46, 252, 417, 582, 703, 855, 925, 1047
Hpy188III TCNNGA 3 cut(s) 31, 136, 1034
Hpy8I GTNNAC 1 cut(s) 834
HpyAV CCTTC 8 cut(s) 135, 252, 300, 417, 465, 582, 630, 1002
HpyCH4III ACNGT 2 cut(s) 831, 1029
HpyCH4IV ACGT 2 cut(s) 746, 979
HpyCH4V TGCA 8 cut(s) 173, 338, 503, 668, 710, 733, 866, 1061
HpyF10VI GCNNNNNNNGC 4 cut(s) 170, 335, 500, 665
HpyF3I CTNAG 5 cut(s) 141, 201, 366, 531, 1004
HpySE526I ACGT 2 cut(s) 746, 979
Hsp92II CATG 2 cut(s) 842, 1055
KflI GGGWCCC 4 cut(s) 146, 311, 476, 641
Kzo9I GATC 2 cut(s) 41, 167
Lsp1109I GCAGC 3 cut(s) 83, 185, 1030
LweI GCATC 2 cut(s) 720, 887
MaeII ACGT 2 cut(s) 746, 979
MaeIII GTNAC 4 cut(s) 340, 505, 682, 797
MalI GATC 2 cut(s) 43, 169
MboI GATC 2 cut(s) 41, 167
MflI RGATCY 1 cut(s) 167
MmeI TCCRAC 2 cut(s) 702, 823
MnlI CCTC 9 cut(s) 93, 136, 196, 258, 361, 423, 526, 588, 858
MroXI GAANNNNTTC 1 cut(s) 1012
MseI TTAA 1 cut(s) 690
MslI CAYNNNNRTG 1 cut(s) 883
MspR9I CCNGG 1 cut(s) 1074
MvaI CCWGG 1 cut(s) 1074
MwoI GCNNNNNNNGC 4 cut(s) 170, 335, 500, 665
NdeII GATC 2 cut(s) 41, 167
NheI GCTAGC 1 cut(s) 55
NlaIII CATG 2 cut(s) 842, 1055
NmuCI GTSAC 1 cut(s) 682
NspI RCATGY 1 cut(s) 842
PciI ACATGT 1 cut(s) 838
PdmI GAANNNNTTC 1 cut(s) 1012
PfeI GAWTC 7 cut(s) 47, 212, 377, 542, 725, 817, 917
PkrI GCNGC 3 cut(s) 73, 175, 1020
Ppu21I YACGTR 2 cut(s) 747, 980
PpuMI RGGWCCY 4 cut(s) 146, 311, 476, 641
PscI ACATGT 1 cut(s) 838
Psp5II RGGWCCY 4 cut(s) 146, 311, 476, 641
Psp6I CCWGG 1 cut(s) 1072
PspGI CCWGG 1 cut(s) 1072
PspPI GGNCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
PspPPI RGGWCCY 4 cut(s) 146, 311, 476, 641
PstI CTGCAG 1 cut(s) 175
PstNI CAGNNNCTG 1 cut(s) 707
PsuI RGATCY 1 cut(s) 167
RseI CAYNNNNRTG 1 cut(s) 883
SaqAI TTAA 1 cut(s) 690
SatI GCNGC 3 cut(s) 72, 174, 1019
Sau3AI GATC 2 cut(s) 41, 167
Sau96I GGNCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
ScrFI CCNGG 1 cut(s) 1074
SetI ASST 8 cut(s) 76, 749, 789, 850, 907, 955, 977, 982
SfaNI GCATC 2 cut(s) 720, 887
SfcI CTRYAG 1 cut(s) 171
SinI GGWCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
SmiMI CAYNNNNRTG 1 cut(s) 883
SnaBI TACGTA 1 cut(s) 747
SspI AATATT 5 cut(s) 95, 155, 260, 425, 590
StyD4I CCNGG 1 cut(s) 1072
TaaI ACNGT 2 cut(s) 831, 1029
TaiI ACGT 2 cut(s) 749, 982
TaqI TCGA 2 cut(s) 85, 728
TfiI GAWTC 7 cut(s) 47, 212, 377, 542, 725, 817, 917
Tru1I TTAA 1 cut(s) 690
Tru9I TTAA 1 cut(s) 690
TscAI CASTG 1 cut(s) 890
TseFI GTSAC 1 cut(s) 682
TseI GCWGC 3 cut(s) 71, 173, 1018
Tsp45I GTSAC 1 cut(s) 682
TspDTI ATGAA 9 cut(s) 81, 120, 246, 285, 411, 450, 576, 615, 909
TspRI CASTG 1 cut(s) 890
VpaK11BI GGWCC 8 cut(s) 146, 206, 311, 371, 476, 536, 641, 845
XbaI TCTAGA 1 cut(s) 1033
XceI RCATGY 1 cut(s) 842
XmnI GAANNNNTTC 1 cut(s) 1012
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.