Rmu_sc0003022.1_g000006

Indole-3-acetic acid-amido synthetase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003022.1
Physical Location & Seq
Forward (+)
16720 .. 17001
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003022.1_g000006.1.cds

Sequence Viewer

Length: 282 bp
atgcaactgtggcaaagtacactagctatgttgacactttcaacaattccaggccactatgtgcttttctgggagcttcgcctaaatggctcaactcctatcccaccctcagtgtttgaggactgttgctttgccattgaggagtcactcaatagtgtgtaccgccaaggaagagtctccaacaaatcgatcgggccactggagatcaagattgttcaggctgggacttttgacaagctcatcaactatgccataagcttgggagcttccattaaccaataa

Protein Analysis

93

Amino Acids

10.33

Weight (kDa)

5.64

Isoelectric Point (pI)

39.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021398)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0412851
rosa_multiflora Rmu_sc0003022.1_g000006
rosa_samantha Rh4BG176300 Rh4CG187000 Rh4DG173000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 163
AdeI CACNNNGTG 1 cut(s) 61
AfaI GTAC 2 cut(s) 19, 161
AgsI TTSAA 1 cut(s) 42
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 5 cut(s) 26, 76, 238, 258, 266
AluI AGCT 5 cut(s) 26, 76, 238, 258, 266
Alw26I GTCTC 1 cut(s) 181
AoxI GGCC 2 cut(s) 52, 194
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
AspS9I GGNCC 1 cut(s) 194
BciT130I CCWGG 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 181
BfaI CTAG 1 cut(s) 23
BglI GCCNNNNNGGC 1 cut(s) 87
Bme1390I CCNGG 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 51
BpmI CTGGAG 1 cut(s) 221
Bsa29I ATCGAT 1 cut(s) 188
BsaJI CCNNGG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 204
BseBI CCWGG 1 cut(s) 51
BseCI ATCGAT 1 cut(s) 188
BseDI CCNNGG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 204
BseRI GAGGAG 1 cut(s) 155
BseYI CCCAGC 1 cut(s) 221
Bsh1285I CGRYCG 1 cut(s) 192
BshFI GGCC 2 cut(s) 54, 196
BshVI ATCGAT 1 cut(s) 188
BsiEI CGRYCG 1 cut(s) 192
BslFI GGGAC 1 cut(s) 238
BsmAI GTCTC 1 cut(s) 181
BsmFI GGGAC 1 cut(s) 238
BsnI GGCC 2 cut(s) 54, 196
Bsp143I GATC 2 cut(s) 189, 204
BspACI CCGC 1 cut(s) 163
BspANI GGCC 2 cut(s) 54, 196
BspCNI CTCAG 1 cut(s) 122
BspDI ATCGAT 1 cut(s) 188
BsrI ACTGG 1 cut(s) 204
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 2 cut(s) 189, 204
BssT1I CCWWGG 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 51
Bst4CI ACNGT 2 cut(s) 9, 125
Bst6I CTCTTC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 2 cut(s) 192, 207
BstMAI GTCTC 1 cut(s) 181
BstMBI GATC 2 cut(s) 189, 204
BstMCI CGRYCG 1 cut(s) 192
BstMWI GCNNNNNNNGC 2 cut(s) 10, 87
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstXI CCANNNNNNTGG 1 cut(s) 259
Bsu15I ATCGAT 1 cut(s) 188
BsuRI GGCC 2 cut(s) 54, 196
BsuTUI ATCGAT 1 cut(s) 188
BtsIMutI CAGTG 2 cut(s) 117, 197
Cfr13I GGNCC 1 cut(s) 194
ClaI ATCGAT 1 cut(s) 188
Csp6I GTAC 2 cut(s) 18, 160
CviJI RGCY 9 cut(s) 26, 54, 76, 90, 196, 221, 238, 258, 266
CviKI_1 RGCY 9 cut(s) 26, 54, 76, 90, 196, 221, 238, 258, 266
CviQI GTAC 2 cut(s) 18, 160
DdeI CTNAG 1 cut(s) 109
DpnI GATC 2 cut(s) 191, 206
DpnII GATC 2 cut(s) 189, 204
DraIII CACNNNGTG 1 cut(s) 61
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco130I CCWWGG 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaiI YATR 4 cut(s) 29, 60, 249, 254
FaqI GGGAC 1 cut(s) 238
FspBI CTAG 1 cut(s) 23
GsaI CCCAGC 1 cut(s) 225
GsuI CTGGAG 1 cut(s) 221
HaeIII GGCC 2 cut(s) 54, 196
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
HindIII AAGCTT 1 cut(s) 256
HinfI GANTC 2 cut(s) 143, 174
Hpy166II GTNNAC 3 cut(s) 20, 33, 160
Hpy188III TCNNGA 1 cut(s) 208
Hpy8I GTNNAC 3 cut(s) 20, 33, 160
HpyCH4III ACNGT 2 cut(s) 9, 125
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 87
HpyF3I CTNAG 1 cut(s) 109
Kzo9I GATC 2 cut(s) 189, 204
LmnI GCTCC 2 cut(s) 73, 263
LpnPI CCDG 6 cut(s) 36, 55, 63, 185, 203, 207
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 144
MalI GATC 2 cut(s) 191, 206
MboI GATC 2 cut(s) 189, 204
MboII GAAGA 1 cut(s) 183
MluCI AATT 1 cut(s) 45
MlyI GAGTC 2 cut(s) 152, 183
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 3 cut(s) 112, 118, 133
MseI TTAA 1 cut(s) 273
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
MwoI GCNNNNNNNGC 2 cut(s) 10, 87
NdeII GATC 2 cut(s) 189, 204
NmuCI GTSAC 1 cut(s) 144
Ple19I CGATCG 1 cut(s) 192
PleI GAGTC 2 cut(s) 151, 182
PpsI GAGTC 2 cut(s) 151, 182
Psp6I CCWGG 1 cut(s) 49
PspFI CCCAGC 1 cut(s) 221
PspGI CCWGG 1 cut(s) 49
PspPI GGNCC 1 cut(s) 194
PvuI CGATCG 1 cut(s) 192
RsaI GTAC 2 cut(s) 19, 161
RsaNI GTAC 2 cut(s) 18, 160
SaqAI TTAA 1 cut(s) 273
Sau3AI GATC 2 cut(s) 189, 204
Sau96I GGNCC 1 cut(s) 194
SchI GAGTC 2 cut(s) 152, 183
ScrFI CCNGG 1 cut(s) 51
SetI ASST 5 cut(s) 28, 78, 240, 260, 268
Sse9I AATT 1 cut(s) 45
SsiI CCGC 1 cut(s) 163
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 49
StyI CCWWGG 1 cut(s) 166
TaaI ACNGT 2 cut(s) 9, 125
TaqI TCGA 1 cut(s) 188
TasI AATT 1 cut(s) 45
TatI WGTACW 1 cut(s) 17
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 2 cut(s) 117, 204
TseFI GTSAC 1 cut(s) 144
Tsp45I GTSAC 1 cut(s) 144
TspRI CASTG 2 cut(s) 117, 204
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.