Rmu_sc0003270.1_g000031

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003270.1
OG0021661
Physical Location & Seq
Reverse (-)
104061 .. 104690
630 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 630 bp
atgataaatggtaagtacaaggagctttatgaagcctccagacaaatccttaagaaaaatgaaaaattgagtgaagagattgttttgatcaagagagagaaaacggaggttgaagagagattggagtcctgtgtcaaaaaatgggaggttgaaaggtctgacttcgttagtcaaatcaaggttttagaagaaaatttgaatgctcaggccactcttgctagctcacttacttctgagaaattaagccttgaacttgagttgaaagagtctcagcaaaagttctctaaattctcaattgggtcagacaaagtgtctaaaatgattaggatgggaaaatctgaatgtgtcaaaaagggcataggttttagttatggtgagagctctaaatctttgaaatttgtaaagagtttaggattccttcaacctgaaaatgccaatgatagaagagacagagagtctagttctagagagcatgataggcgttcaagtttagcaaagaattatgtgcttcctaaacttggatatcattctttgtctagaaagttcaccattatttgtcaccattatggaactccaggtcacataagacttaagtgtaactatctttggagaaattcacaaagggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 gag_pre-integrs rve zf-CCHC

Protein Analysis

209

Amino Acids

24.26

Weight (kDa)

9.56

Isoelectric Point (pI)

51.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021661)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003270.1_g000031
rosa_samantha Rh2BG031700 Rh2BG574900 Rh5BG376300 Rh5BG450700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 193, 287, 395, 613
AfaI GTAC 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 518
AflII CTTAAG 2 cut(s) 50, 590
AgsI TTSAA 8 cut(s) 113, 152, 199, 251, 262, 394, 422, 486
AhdI GACNNNNNGTC 2 cut(s) 310, 454
AjnI CCWGG 1 cut(s) 574
AluBI AGCT 3 cut(s) 25, 222, 381
AluI AGCT 3 cut(s) 25, 222, 381
Alw21I GWGCWC 1 cut(s) 383
Alw26I GTCTC 2 cut(s) 273, 441
AoxI GGCC 1 cut(s) 207
ApoI RAATTY 4 cut(s) 193, 287, 395, 613
AsuHPI GGTGA 3 cut(s) 386, 538, 551
AsuNHI GCTAGC 1 cut(s) 218
BanII GRGCYC 1 cut(s) 383
Bbv12I GWGCWC 1 cut(s) 383
BccI CCATC 1 cut(s) 322
BciT130I CCWGG 1 cut(s) 576
BclI TGATCA 1 cut(s) 87
BcoDI GTCTC 2 cut(s) 273, 441
BfaI CTAG 5 cut(s) 219, 459, 465, 537, 628
BfrI CTTAAG 2 cut(s) 50, 590
Bme1390I CCNGG 1 cut(s) 576
BmeRI GACNNNNNGTC 2 cut(s) 310, 454
BmrFI CCNGG 1 cut(s) 576
BmtI GCTAGC 1 cut(s) 222
BpmI CTGGAG 2 cut(s) 22, 558
Bpu10I CCTNAGC 1 cut(s) 204
BpuEI CTTGAG 1 cut(s) 275
Bsc4I CCNNNNNNNGG 1 cut(s) 518
BseBI CCWGG 1 cut(s) 576
BseGI GGATG 1 cut(s) 333
BseLI CCNNNNNNNGG 1 cut(s) 518
BseMII CTCAG 3 cut(s) 218, 225, 284
BshFI GGCC 1 cut(s) 209
BsiHKAI GWGCWC 1 cut(s) 383
BslI CCNNNNNNNGG 1 cut(s) 518
BsmAI GTCTC 2 cut(s) 273, 441
BsmI GAATGC 1 cut(s) 205
BsnI GGCC 1 cut(s) 209
Bsp1286I GDGCHC 1 cut(s) 383
Bsp143I GATC 1 cut(s) 87
BspANI GGCC 1 cut(s) 209
BspCNI CTCAG 3 cut(s) 217, 226, 283
BspOI GCTAGC 1 cut(s) 222
BspTI CTTAAG 2 cut(s) 50, 590
BssMI GATC 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 576
Bst6I CTCTTC 3 cut(s) 69, 108, 439
BstAFI CTTAAG 2 cut(s) 50, 590
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 3 cut(s) 204, 234, 270
BstF5I GGATG 1 cut(s) 333
BstKTI GATC 1 cut(s) 90
BstMAI GTCTC 2 cut(s) 273, 441
BstMBI GATC 1 cut(s) 87
BstMWI GCNNNNNNNGC 2 cut(s) 215, 478
BstNI CCWGG 1 cut(s) 576
BstSCI CCNGG 1 cut(s) 574
BsuRI GGCC 1 cut(s) 209
BtsCI GGATG 1 cut(s) 333
Cac8I GCNNGC 1 cut(s) 220
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 473
CviJI RGCY 6 cut(s) 25, 35, 209, 222, 246, 381
CviKI_1 RGCY 6 cut(s) 25, 35, 209, 222, 246, 381
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 3 cut(s) 204, 234, 270
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
DriI GACNNNNNGTC 2 cut(s) 310, 454
Eam1104I CTCTTC 3 cut(s) 69, 108, 439
Eam1105I GACNNNNNGTC 2 cut(s) 310, 454
EarI CTCTTC 3 cut(s) 69, 108, 439
Ecl136II GAGCTC 1 cut(s) 381
Eco24I GRGCYC 1 cut(s) 383
Eco32I GATATC 1 cut(s) 524
Eco53kI GAGCTC 1 cut(s) 381
EcoICRI GAGCTC 1 cut(s) 381
EcoRII CCWGG 1 cut(s) 574
EcoRV GATATC 1 cut(s) 524
EcoT38I GRGCYC 1 cut(s) 383
FaeI CATG 1 cut(s) 476
FaiI YATR 7 cut(s) 30, 359, 372, 474, 504, 567, 584
FatI CATG 1 cut(s) 472
FbaI TGATCA 1 cut(s) 87
FokI GGATG 1 cut(s) 340
FriOI GRGCYC 1 cut(s) 383
FspBI CTAG 5 cut(s) 219, 459, 465, 537, 628
GsuI CTGGAG 2 cut(s) 22, 558
HaeIII GGCC 1 cut(s) 209
Hin1II CATG 1 cut(s) 476
HinfI GANTC 4 cut(s) 125, 266, 414, 455
HphI GGTGA 3 cut(s) 386, 538, 551
Hpy166II GTNNAC 1 cut(s) 546
Hpy188I TCNGA 4 cut(s) 160, 235, 304, 340
Hpy188III TCNNGA 4 cut(s) 39, 91, 465, 537
Hpy8I GTNNAC 1 cut(s) 546
HpyAV CCTTC 1 cut(s) 428
HpyF10VI GCNNNNNNNGC 2 cut(s) 215, 478
HpyF3I CTNAG 3 cut(s) 204, 234, 270
Hsp92II CATG 1 cut(s) 476
Ksp22I TGATCA 1 cut(s) 87
Kzo9I GATC 1 cut(s) 87
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 6 cut(s) 52, 142, 191, 438, 561, 588
MaeI CTAG 5 cut(s) 219, 459, 465, 537, 628
MaeIII GTNAC 3 cut(s) 557, 578, 596
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 4 cut(s) 86, 125, 200, 456
MfeI CAATTG 1 cut(s) 294
MhlI GDGCHC 1 cut(s) 383
MluCI AATT 8 cut(s) 65, 193, 239, 287, 294, 395, 499, 613
MlyI GAGTC 3 cut(s) 134, 275, 464
MnlI CCTC 3 cut(s) 46, 100, 139
MseI TTAA 3 cut(s) 51, 242, 591
MslI CAYNNNNRTG 1 cut(s) 564
MspCI CTTAAG 2 cut(s) 50, 590
MspR9I CCNGG 1 cut(s) 576
MunI CAATTG 1 cut(s) 294
Mva1269I GAATGC 1 cut(s) 205
MvaI CCWGG 1 cut(s) 576
MwoI GCNNNNNNNGC 2 cut(s) 215, 478
NdeII GATC 1 cut(s) 87
NheI GCTAGC 1 cut(s) 218
NlaIII CATG 1 cut(s) 476
NmuCI GTSAC 2 cut(s) 557, 578
PctI GAATGC 1 cut(s) 205
PfeI GAWTC 1 cut(s) 414
PleI GAGTC 3 cut(s) 133, 274, 463
PpsI GAGTC 3 cut(s) 133, 274, 463
Psp124BI GAGCTC 1 cut(s) 383
Psp6I CCWGG 1 cut(s) 574
PspGI CCWGG 1 cut(s) 574
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 564
SacI GAGCTC 1 cut(s) 383
SaqAI TTAA 3 cut(s) 51, 242, 591
Sau3AI GATC 1 cut(s) 87
SchI GAGTC 3 cut(s) 134, 275, 464
ScrFI CCNGG 1 cut(s) 576
SduI GDGCHC 1 cut(s) 383
SmiMI CAYNNNNRTG 1 cut(s) 564
SmlI CTYRAG 3 cut(s) 50, 254, 590
SmoI CTYRAG 3 cut(s) 50, 254, 590
Sse9I AATT 8 cut(s) 65, 193, 239, 287, 294, 395, 499, 613
SspMI CTAG 5 cut(s) 219, 459, 465, 537, 628
SstI GAGCTC 1 cut(s) 383
StyD4I CCNGG 1 cut(s) 574
TasI AATT 8 cut(s) 65, 193, 239, 287, 294, 395, 499, 613
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 1 cut(s) 414
Tru1I TTAA 3 cut(s) 51, 242, 591
Tru9I TTAA 3 cut(s) 51, 242, 591
TseFI GTSAC 2 cut(s) 557, 578
Tsp45I GTSAC 2 cut(s) 557, 578
TspDTI ATGAA 2 cut(s) 45, 75
TspGWI ACGGA 1 cut(s) 119
Vha464I CTTAAG 2 cut(s) 50, 590
XapI RAATTY 4 cut(s) 193, 287, 395, 613
XbaI TCTAGA 2 cut(s) 464, 536
XspI CTAG 5 cut(s) 219, 459, 465, 537, 628
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.