Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003417.1

Orthogroup ID

OG0006273

Physical Location & Seq

Genomic Coordinates Reverse (-)

52756 .. 60364

Gene Structure 7609 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003417.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1962 bp

atgcgacaggctgagtcatcatcttcaaggctcggtgtcaatggaaggtctgtgaaaatggtgccagctagtgaggtaatgaaaaggcaaaccccatctactaataaggctgacatagtgaatggagtgaatggttcgaagccggttgttaatggagcaagtctagttagaaaacattctactccagctgcaaccttggttaagacacagaaatctaaaacttctaaagaacttcccccgttcgaggagctaagagttttgccatcagatgaaagcttcagttgggccaatgaaaactataattcatggcaacgatctgcagatgtatggtcttttgttctctcattgcgtgttcgtgttctgttcgacaatgcaaaatgggcatatataggaggtttcacagaagataagcagaaaatcagaaggcgaaagaccgcctcatggctgcgagagcgtgtattgcagcttggcccaacttttatcaaactcggacaattatcttcaacaagatcagatctatttccgcaggagtttgtggacgagcttgccaaattacaggatagggttcccgccttctcaccagccaaagcgaaaggctttattaagactgaattaggagctcccatcaatatattgtttaaggagttcgaggaccagccaattgctgctgctagtcttggtcaggttcatcgcgctatcctacataatggagagaaagtagtcgtgaaagttcaaagacctggtctgaagaagctttttgacattgacctaaaaaatctgaagctaattgcagagtatttccagagaagtgaaagccttggtggtccatcaagggactggattggggtatatgaagaatgtgccacgattttgtatcaagaaattgattatataaatgaagggaagaacgctgacagatttcgcagagactttcggaatataaagtgggttcgagtacctatggtcttttgggattacactgccacgaaggtgttgacattggagtatgttccaggtattaagataaacaggctagatatgctagacgcgcagggatttgatcgttctcaaattgcatcacatgctattgaagcatacttgatccagatactcagaaccggtttcttccatgctgatcctcatccaggaaatctcgctgttgatgtggatgaaactctaatctattatgattttggcatgatgggagatattaaatctttcacccgagagagactacttgaacttttctattctgtatatgagaaagatgccaaaaaggttatgcaatgcctcataaatcttggagcacttcagcccacaggagatttatcttccgtaaggagatccgttcaattctttttggataatttgctaagccagacaccagatcagcagactactttttctgcaataggggaggatttatttgcaatagcacaagatcaaccatttcgatttccatccacatttacttttgttctcagggcattctcaaccctagaaggtataggctatattctaaatccagatttctccttcgtgaagattgctgcaccttatgcccaggaactcttagatttaagacagaagcggcgtactgggacacaacttgtaaatgaaatcaggaaacaagccgatgatgccagaagctacacaatgtccatgccatacagagttcagagaatagaggagtttgtgaaagaacttgagtcgggggatctgaaactccgagttcgggtgcttgagtcagaaagagctgctaagaaagcaaatattctccaaatggcgacgatatatacagtcttgggaagttctctgcttaaccttggggtcactttgggcagtcaaggcaatctggcttttgcaaatgggtcatacattggtgcaggagttcttttcgcactgtttgctagattgttgctctgcacatctctaccaaacacccaaaacccaaagatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

ABC1

Protein Analysis

653

Amino Acids

73.79

Weight (kDa)

9.34

Isoelectric Point (pI)

45.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006273)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07700 AT3G07700 AT3G07700 AT3G07700
fragaria_vesca	FvH4_6g40570 FvH4_6g40570 FvH4_6g40570 FvH4_6g40570 FvH4_6g40570 FvH4_6g40570
malus_domestica	MD09G1128300.v1.1
prunus_persica	Prupe.3G196900_v2.0.a1 Prupe.3G196900_v2.0.a1 Prupe.3G196900_v2.0.a1
pyrus_communis	pycom09g05190 pycom09g05200
rosa_chinensis	RchiOBHm_Chr2g0155831
rosa_laevigata	RLG00000020866
rosa_multiflora	Rmu_sc0003417.1_g000013 Rmu_sc0018914.1_g000002
rosa_roxburghii	Rroxscaffold_2G00093450
rosa_rugosa	Rorug02G0450100
rosa_samantha	Rh2AG516500 Rh2BG527300 Rh2CG501400 Rh2DG536500
rosa_wichuraiana	Rw2G042480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	61
AccII	CGCG	2 cut(s)	693, 1049
AciI	CCGC	4 cut(s)	435, 524, 570, 1591
AclWI	GGATC	4 cut(s)	1096, 1130, 1338, 1725
AcuI	CTGAAG	4 cut(s)	262, 767, 800, 1295
AfaI	GTAC	2 cut(s)	957, 1597
AfiI	CCNNNNNNNGG	4 cut(s)	244, 441, 1145, 1735
AgeI	ACCGGT	1 cut(s)	1118
AgsI	TTSAA	6 cut(s)	27, 504, 734, 1091, 1241, 1352
AjnI	CCWGG	4 cut(s)	739, 1012, 1144, 1563
AleI	CACNNNNGTG	1 cut(s)	989
Alw21I	GWGCWC	2 cut(s)	622, 1309
Alw26I	GTCTC	2 cut(s)	921, 1225
AlwI	GGATC	4 cut(s)	1096, 1130, 1338, 1725
Ama87I	CYCGRG	1 cut(s)	1224
AoxI	GGCC	2 cut(s)	285, 469
ApeKI	GCWGC	7 cut(s)	188, 445, 463, 665, 668, 1550, 1757
ArsI	GACNNNNNNTTYG	2 cut(s)	727, 759
AsiGI	ACCGGT	1 cut(s)	1118
Asp700I	GAANNNNTTC	1 cut(s)	175
AspLEI	GCGC	2 cut(s)	695, 1051
AspS9I	GGNCC	4 cut(s)	285, 470, 652, 824
AsuHPI	GGTGA	2 cut(s)	570, 1213
AsuII	TTCGAA	1 cut(s)	137
AvaI	CYCGRG	1 cut(s)	1224
AvaII	GGWCC	2 cut(s)	652, 824
BanI	GGYRCC	1 cut(s)	61
BanII	GRGCYC	1 cut(s)	622
Bbv12I	GWGCWC	2 cut(s)	622, 1309
BbvI	GCAGC	7 cut(s)	175, 432, 475, 652, 655, 1537, 1744
BccI	CCATC	6 cut(s)	103, 271, 632, 835, 1195, 1468
BciT130I	CCWGG	4 cut(s)	741, 1014, 1146, 1565
BcoDI	GTCTC	2 cut(s)	921, 1225
BfaI	CTAG	8 cut(s)	69, 164, 672, 1034, 1043, 1499, 1911, 1960
BfmI	CTRYAG	1 cut(s)	318
BglII	AGATCT	2 cut(s)	514, 1956
BisI	GCNGC	8 cut(s)	189, 446, 464, 666, 669, 1551, 1592, 1758
BlpI	GCTNAGC	1 cut(s)	1373
BlsI	GCNGC	8 cut(s)	190, 447, 465, 667, 670, 1552, 1593, 1759
Bme1390I	CCNGG	4 cut(s)	741, 1014, 1146, 1565
Bme18I	GGWCC	2 cut(s)	652, 824
BmeT110I	CYCGRG	1 cut(s)	1224
BmgT120I	GGNCC	4 cut(s)	285, 470, 652, 824
BmiI	GGNNCC	2 cut(s)	63, 567
BmrFI	CCNGG	4 cut(s)	741, 1014, 1146, 1565
BmrI	ACTGGG	1 cut(s)	1608
BmsI	GCATC	3 cut(s)	1085, 1258, 1630
BmuI	ACTGGG	1 cut(s)	1608
BpmI	CTGGAG	1 cut(s)	168
Bpu1102I	GCTNAGC	1 cut(s)	1373
Bpu14I	TTCGAA	1 cut(s)	137
BpuEI	CTTGAG	2 cut(s)	1727, 1763
BsaBI	GATNNNNATC	2 cut(s)	1140, 1459
BsaJI	CCNNGG	4 cut(s)	195, 817, 1563, 1825
BsaWI	WCCGGW	1 cut(s)	1118
BsaXI	ACNNNNNCTCC	2 cut(s)	702, 732
Bsc4I	CCNNNNNNNGG	4 cut(s)	244, 441, 1145, 1735
Bse118I	RCCGGY	2 cut(s)	142, 1118
Bse1I	ACTGG	2 cut(s)	842, 1603
Bse3DI	GCAATG	2 cut(s)	344, 1292
Bse8I	GATNNNNATC	2 cut(s)	1140, 1459
BseBI	CCWGG	4 cut(s)	741, 1014, 1146, 1565
BseDI	CCNNGG	4 cut(s)	195, 817, 1563, 1825
BseGI	GGATG	3 cut(s)	1141, 1174, 1460
BseJI	GATNNNNATC	2 cut(s)	1140, 1459
BseLI	CCNNNNNNNGG	4 cut(s)	244, 441, 1145, 1735
BseMI	GCAATG	2 cut(s)	344, 1292
BseMII	CTCAG	2 cut(s)	1126, 1495
BseNI	ACTGG	2 cut(s)	842, 1603
BseRI	GAGGAG	2 cut(s)	260, 1703
BseXI	GCAGC	7 cut(s)	175, 432, 475, 652, 655, 1537, 1744
BsgI	GTGCAG	3 cut(s)	1536, 1905, 1909
Bsh1236I	CGCG	2 cut(s)	693, 1049
BshFI	GGCC	2 cut(s)	287, 471
BshNI	GGYRCC	1 cut(s)	61
BshTI	ACCGGT	1 cut(s)	1118
BsiHKAI	GWGCWC	2 cut(s)	622, 1309
BsiHKCI	CYCGRG	1 cut(s)	1224
BsiSI	CCGG	2 cut(s)	143, 1119
BslFI	GGGAC	2 cut(s)	848, 1615
BslI	CCNNNNNNNGG	4 cut(s)	244, 441, 1145, 1735
BsmAI	GTCTC	2 cut(s)	921, 1225
BsmFI	GGGAC	2 cut(s)	848, 1615
BsmI	GAATGC	1 cut(s)	1487
BsnI	GGCC	2 cut(s)	287, 471
BsoBI	CYCGRG	1 cut(s)	1224
Bsp119I	TTCGAA	1 cut(s)	137
Bsp1286I	GDGCHC	2 cut(s)	622, 1309
Bsp1720I	GCTNAGC	1 cut(s)	1373
BspACI	CCGC	4 cut(s)	435, 524, 570, 1591
BspANI	GGCC	2 cut(s)	287, 471
BspCNI	CTCAG	3 cut(s)	4, 1125, 1494
BspFNI	CGCG	2 cut(s)	693, 1049
BspLI	GGNNCC	2 cut(s)	63, 567
BspMAI	CTGCAG	1 cut(s)	322
BspPI	GGATC	4 cut(s)	1096, 1130, 1338, 1725
BspT104I	TTCGAA	1 cut(s)	137
BspT107I	GGYRCC	1 cut(s)	61
BsrDI	GCAATG	2 cut(s)	344, 1292
BsrFI	RCCGGY	2 cut(s)	142, 1118
BsrI	ACTGG	2 cut(s)	842, 1603
BssAI	RCCGGY	2 cut(s)	142, 1118
BssECI	CCNNGG	4 cut(s)	195, 817, 1563, 1825
BssT1I	CCWWGG	3 cut(s)	195, 817, 1825
Bst2UI	CCWGG	4 cut(s)	741, 1014, 1146, 1565
Bst4CI	ACNGT	2 cut(s)	1801, 1905
BstAPI	GCANNNNNTGC	3 cut(s)	1082, 1559, 1907
BstBI	TTCGAA	1 cut(s)	137
BstC8I	GCNNGC	2 cut(s)	66, 546
BstDEI	CTNAG	7 cut(s)	12, 251, 1112, 1373, 1481, 1573, 1761
BstENI	CCTNNNNNAGG	1 cut(s)	1143
BstF5I	GGATG	3 cut(s)	1141, 1174, 1460
BstFNI	CGCG	2 cut(s)	693, 1049
BstHHI	GCGC	2 cut(s)	695, 1051
BstMAI	GTCTC	2 cut(s)	921, 1225
BstNI	CCWGG	4 cut(s)	741, 1014, 1146, 1565
BstNSI	RCATGY	1 cut(s)	1085
BstSCI	CCNGG	4 cut(s)	739, 1012, 1144, 1563
BstSFI	CTRYAG	1 cut(s)	318
BstUI	CGCG	2 cut(s)	693, 1049
BstV1I	GCAGC	7 cut(s)	175, 432, 475, 652, 655, 1537, 1744
BstX2I	RGATCY	4 cut(s)	514, 1343, 1717, 1956
BstYI	RGATCY	4 cut(s)	514, 1343, 1717, 1956
BsuRI	GGCC	2 cut(s)	287, 471
BtgZI	GCGATG	1 cut(s)	674
BtsCI	GGATG	3 cut(s)	1141, 1174, 1460
BtsI	GCAGTG	1 cut(s)	978
BtsIMutI	CAGTG	2 cut(s)	978, 1901
Cac8I	GCNNGC	2 cut(s)	66, 546
CfoI	GCGC	2 cut(s)	695, 1051
Cfr10I	RCCGGY	2 cut(s)	142, 1118
Cfr13I	GGNCC	4 cut(s)	285, 470, 652, 824
CseI	GACGC	1 cut(s)	1055
CsiI	ACCWGGT	1 cut(s)	739
Csp6I	GTAC	2 cut(s)	956, 1596
CspAI	ACCGGT	1 cut(s)	1118
CviAII	CATG	6 cut(s)	306, 441, 1082, 1130, 1198, 1663
CviQI	GTAC	2 cut(s)	956, 1596
DdeI	CTNAG	7 cut(s)	12, 251, 1112, 1373, 1481, 1573, 1761
Ecl136II	GAGCTC	1 cut(s)	620
Eco130I	CCWWGG	3 cut(s)	195, 817, 1825
Eco24I	GRGCYC	1 cut(s)	622
Eco47I	GGWCC	2 cut(s)	652, 824
Eco53kI	GAGCTC	1 cut(s)	620
Eco57I	CTGAAG	4 cut(s)	262, 767, 800, 1295
Eco88I	CYCGRG	1 cut(s)	1224
EcoICRI	GAGCTC	1 cut(s)	620
EcoNI	CCTNNNNNAGG	1 cut(s)	1143
EcoRII	CCWGG	4 cut(s)	739, 1012, 1144, 1563
EcoT14I	CCWWGG	3 cut(s)	195, 817, 1825
EcoT38I	GRGCYC	1 cut(s)	622
ErhI	CCWWGG	3 cut(s)	195, 817, 1825
FaeI	CATG	6 cut(s)	309, 444, 1085, 1133, 1201, 1666
FaqI	GGGAC	2 cut(s)	848, 1615
FatI	CATG	6 cut(s)	305, 440, 1081, 1129, 1197, 1662
FauI	CCCGC	1 cut(s)	577
Fnu4HI	GCNGC	8 cut(s)	189, 446, 464, 666, 669, 1551, 1592, 1758
FokI	GGATG	3 cut(s)	1128, 1181, 1447
FriOI	GRGCYC	1 cut(s)	622
Fsp4HI	GCNGC	8 cut(s)	189, 446, 464, 666, 669, 1551, 1592, 1758
FspBI	CTAG	8 cut(s)	69, 164, 672, 1034, 1043, 1499, 1911, 1960
GlaI	GCGC	2 cut(s)	694, 1050
GluI	GCNGC	8 cut(s)	189, 446, 464, 666, 669, 1551, 1592, 1758
GsuI	CTGGAG	1 cut(s)	168
HaeIII	GGCC	2 cut(s)	287, 471
HapII	CCGG	2 cut(s)	143, 1119
HgaI	GACGC	1 cut(s)	1055
HhaI	GCGC	2 cut(s)	695, 1051
Hin1II	CATG	6 cut(s)	309, 444, 1085, 1133, 1201, 1666
Hin6I	GCGC	2 cut(s)	693, 1049
HinP1I	GCGC	2 cut(s)	693, 1049
HincII	GTYRAC	1 cut(s)	996
HindII	GTYRAC	1 cut(s)	996
HindIII	AAGCTT	2 cut(s)	274, 752
HinfI	GANTC	3 cut(s)	14, 1709, 1745
HpaII	CCGG	2 cut(s)	143, 1119
HphI	GGTGA	2 cut(s)	570, 1213
Hpy166II	GTNNAC	2 cut(s)	538, 996
Hpy188III	TCNNGA	7 cut(s)	724, 802, 878, 1105, 1526, 1540, 1624
Hpy8I	GTNNAC	2 cut(s)	538, 996
Hpy99I	CGWCG	1 cut(s)	1792
HpyAV	CCTTC	7 cut(s)	39, 417, 583, 893, 982, 1496, 1546
HpyCH4III	ACNGT	2 cut(s)	1801, 1905
HpyF3I	CTNAG	7 cut(s)	12, 251, 1112, 1373, 1481, 1573, 1761
Hsp92II	CATG	6 cut(s)	309, 444, 1085, 1133, 1201, 1666
HspAI	GCGC	2 cut(s)	693, 1049
LmnI	GCTCC	5 cut(s)	155, 247, 617, 625, 1304
Lsp1109I	GCAGC	7 cut(s)	175, 432, 475, 652, 655, 1537, 1744
LweI	GCATC	3 cut(s)	1085, 1258, 1630
MabI	ACCWGGT	1 cut(s)	739
MaeI	CTAG	8 cut(s)	69, 164, 672, 1034, 1043, 1499, 1911, 1960
MaeIII	GTNAC	1 cut(s)	1831
MboII	GAAGA	9 cut(s)	15, 416, 492, 760, 866, 916, 1117, 1323, 1555
MfeI	CAATTG	1 cut(s)	660
MflI	RGATCY	4 cut(s)	514, 1343, 1717, 1956
MhlI	GDGCHC	2 cut(s)	622, 1309
MlyI	GAGTC	3 cut(s)	23, 1718, 1754
MnlI	CCTC	9 cut(s)	67, 238, 386, 448, 643, 1149, 1301, 1411, 1681
MroXI	GAANNNNTTC	1 cut(s)	175
MseI	TTAA	8 cut(s)	150, 201, 603, 639, 1020, 1212, 1580, 1821
MslI	CAYNNNNRTG	1 cut(s)	989
MspA1I	CMGCKG	1 cut(s)	188
MspI	CCGG	2 cut(s)	143, 1119
MspR9I	CCNGG	4 cut(s)	741, 1014, 1146, 1565
MunI	CAATTG	1 cut(s)	660
Mva1269I	GAATGC	1 cut(s)	1487
MvaI	CCWGG	4 cut(s)	741, 1014, 1146, 1565
MvnI	CGCG	2 cut(s)	693, 1049
NlaIII	CATG	6 cut(s)	309, 444, 1085, 1133, 1201, 1666
NlaIV	GGNNCC	2 cut(s)	63, 567
NmuCI	GTSAC	1 cut(s)	1831
NspI	RCATGY	1 cut(s)	1085
NspV	TTCGAA	1 cut(s)	137
OliI	CACNNNNGTG	1 cut(s)	989
PctI	GAATGC	1 cut(s)	1487
PdmI	GAANNNNTTC	1 cut(s)	175
PflFI	GACNNNGTC	1 cut(s)	741
PfoI	TCCNGGA	1 cut(s)	1144
PinAI	ACCGGT	1 cut(s)	1118
PkrI	GCNGC	8 cut(s)	190, 447, 465, 667, 670, 1552, 1593, 1759
PleI	GAGTC	3 cut(s)	22, 1717, 1753
PpsI	GAGTC	3 cut(s)	22, 1717, 1753
Psp124BI	GAGCTC	1 cut(s)	622
Psp6I	CCWGG	4 cut(s)	739, 1012, 1144, 1563
PspGI	CCWGG	4 cut(s)	739, 1012, 1144, 1563
PspN4I	GGNNCC	2 cut(s)	63, 567
PspPI	GGNCC	4 cut(s)	285, 470, 652, 824
PstI	CTGCAG	1 cut(s)	322
PsuI	RGATCY	4 cut(s)	514, 1343, 1717, 1956
PsyI	GACNNNGTC	1 cut(s)	741
PvuII	CAGCTG	1 cut(s)	188
RsaI	GTAC	2 cut(s)	957, 1597
RsaNI	GTAC	2 cut(s)	956, 1596
RseI	CAYNNNNRTG	1 cut(s)	989
SacI	GAGCTC	1 cut(s)	622
SaqAI	TTAA	8 cut(s)	150, 201, 603, 639, 1020, 1212, 1580, 1821
SatI	GCNGC	8 cut(s)	189, 446, 464, 666, 669, 1551, 1592, 1758
Sau96I	GGNCC	4 cut(s)	285, 470, 652, 824
SchI	GAGTC	3 cut(s)	23, 1718, 1754
ScrFI	CCNGG	4 cut(s)	741, 1014, 1146, 1565
SduI	GDGCHC	2 cut(s)	622, 1309
SexAI	ACCWGGT	1 cut(s)	739
SfaNI	GCATC	3 cut(s)	1085, 1258, 1630
SfcI	CTRYAG	1 cut(s)	318
SfuI	TTCGAA	1 cut(s)	137
SinI	GGWCC	2 cut(s)	652, 824
SmiMI	CAYNNNNRTG	1 cut(s)	989
SmlI	CTYRAG	2 cut(s)	1706, 1742
SmoI	CTYRAG	2 cut(s)	1706, 1742
SsiI	CCGC	4 cut(s)	435, 524, 570, 1591
SspI	AATATT	1 cut(s)	1774
SspMI	CTAG	8 cut(s)	69, 164, 672, 1034, 1043, 1499, 1911, 1960
SstI	GAGCTC	1 cut(s)	622
StyD4I	CCNGG	4 cut(s)	739, 1012, 1144, 1563
StyI	CCWWGG	3 cut(s)	195, 817, 1825
TaaI	ACNGT	2 cut(s)	1801, 1905
TaqI	TCGA	6 cut(s)	137, 243, 366, 648, 952, 1453
TauI	GCSGC	1 cut(s)	1594
Tru1I	TTAA	8 cut(s)	150, 201, 603, 639, 1020, 1212, 1580, 1821
Tru9I	TTAA	8 cut(s)	150, 201, 603, 639, 1020, 1212, 1580, 1821
TscAI	CASTG	2 cut(s)	985, 1908
TseFI	GTSAC	1 cut(s)	1831
TseI	GCWGC	7 cut(s)	188, 445, 463, 665, 668, 1550, 1757
Tsp45I	GTSAC	1 cut(s)	1831
TspDTI	ATGAA	9 cut(s)	95, 285, 294, 306, 677, 867, 912, 1185, 1632
TspGWI	ACGGA	2 cut(s)	1324, 1336
TspRI	CASTG	2 cut(s)	985, 1908
Tth111I	GACNNNGTC	1 cut(s)	741
VpaK11BI	GGWCC	2 cut(s)	652, 824
XagI	CCTNNNNNAGG	1 cut(s)	1143
XceI	RCATGY	1 cut(s)	1085
XcmI	CCANNNNNNNNNTGG	1 cut(s)	834
XmnI	GAANNNNTTC	1 cut(s)	175
XspI	CTAG	8 cut(s)	69, 164, 672, 1034, 1043, 1499, 1911, 1960

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.