Rmu_sc0003851.1_g000001

26S proteasome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003851.1
OG0023101
Physical Location & Seq
Reverse (-)
421 .. 3943
3523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003851.1_g000001.1.cds

Sequence Viewer

Length: 792 bp
atgaatctgagttcttgtttcctttctgttcagcacccaacctcctcctttatctccgaattgcaccgaacagtcctcttcttccttctccgcctccgccttagaccaaaacccgacccttctccacctctaaccatcacccgactaagaacaaagaggagagactggtgtgaggggttagggctcaaagatggtggatgttctagagttcaaggcccccgtttcgaagacgaatcggagcaactgcgaaagaagtgcgcttcgtgtttccgaggtaatttgaatcttttcagtttatggatttggttctgtgtctttgaagtatttaaaattgagttgtacgtggatgagtacactgttcgagttgtggatgtctttgctatgtcgcagagtgttactggtgttagtgttgaagcagtgggtcatgtgttccagactaacatgctcgatatgcttaagcagattggaaggaagaatgaactcgaggagaagatgttgcttaaccttcataagaagaaatggactgatgggctgaccctcaagcgttttgatacacattcaaaaacaaatgagcaaactgttcaagtcgagttggcgtcgatgagaggtctagaaggctcggtgatgtacagcagctgcgcagaagatggtttgcgtttgctgctgaaggtggagtggccgagggtggcttcttggtgcgtgggggctagcagtctgaaggctgtcaacgcaagctgcattgcggtgctgctacaggggcagcagtgcaacgctgcaagcaggcagcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03050 ko05169 map03050 map05169
Pfam Domains
Protein Families
JAB MitMem_reg

Protein Analysis

263

Amino Acids

29.94

Weight (kDa)

9.03

Isoelectric Point (pI)

40.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023101)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003851.1_g000001 Rmu_sc0014514.1_g000001
rosa_roxburghii Rroxscaffold_1G00034570 Rroxscaffold_6G00424740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 640
AciI CCGC 3 cut(s) 91, 97, 743
AcoI YGGCCR 1 cut(s) 677
AcuI CTGAAG 2 cut(s) 686, 737
AcyI GRCGYC 1 cut(s) 596
AfaI GTAC 3 cut(s) 341, 353, 629
AflII CTTAAG 1 cut(s) 455
AgsI TTSAA 6 cut(s) 212, 283, 320, 413, 561, 584
AluBI AGCT 2 cut(s) 636, 735
AluI AGCT 2 cut(s) 636, 735
Alw26I GTCTC 1 cut(s) 156
AlwNI CAGNNNCTG 1 cut(s) 636
Ama87I CYCGRG 1 cut(s) 482
AoxI GGCC 2 cut(s) 214, 677
ApeKI GCWGC 8 cut(s) 633, 636, 661, 735, 748, 760, 773, 784
Asp700I GAANNNNTTC 1 cut(s) 287
AspLEI GCGC 2 cut(s) 260, 641
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 130, 634
AsuII TTCGAA 1 cut(s) 225
AsuNHI GCTAGC 1 cut(s) 707
AvaI CYCGRG 1 cut(s) 482
BanII GRGCYC 1 cut(s) 186
BbsI GAAGAC 1 cut(s) 234
BbvI GCAGC 7 cut(s) 623, 645, 648, 722, 735, 760, 772
BccI CCATC 4 cut(s) 143, 185, 521, 641
BcgI CGANNNNNNTGC 2 cut(s) 237, 271
BcoDI GTCTC 1 cut(s) 156
BfaI CTAG 3 cut(s) 204, 611, 708
BfmI CTRYAG 1 cut(s) 752
BfrI CTTAAG 1 cut(s) 455
BisI GCNGC 8 cut(s) 634, 637, 662, 736, 749, 761, 774, 785
BlsI GCNGC 8 cut(s) 635, 638, 663, 737, 750, 762, 775, 786
BmeT110I CYCGRG 1 cut(s) 482
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 217
BmtI GCTAGC 1 cut(s) 711
BpiI GAAGAC 1 cut(s) 234
Bpu14I TTCGAA 1 cut(s) 225
BpuEI CTTGAG 1 cut(s) 524
BsaAI YACGTR 1 cut(s) 343
BsaHI GRCGYC 1 cut(s) 596
BsaJI CCNNGG 2 cut(s) 271, 680
BsaXI ACNNNNNCTCC 4 cut(s) 26, 56, 479, 509
Bse1I ACTGG 2 cut(s) 170, 403
Bse3DI GCAATG 1 cut(s) 738
BseDI CCNNGG 2 cut(s) 271, 680
BseGI GGATG 3 cut(s) 203, 352, 376
BseMI GCAATG 1 cut(s) 738
BseNI ACTGG 2 cut(s) 170, 403
BseRI GAGGAG 3 cut(s) 34, 172, 500
BseXI GCAGC 7 cut(s) 623, 645, 648, 722, 735, 760, 772
BshFI GGCC 2 cut(s) 216, 679
BsiHKCI CYCGRG 1 cut(s) 482
BsmAI GTCTC 1 cut(s) 156
BsnI GGCC 2 cut(s) 216, 679
BsoBI CYCGRG 1 cut(s) 482
Bsp119I TTCGAA 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 186
Bsp1407I TGTACA 1 cut(s) 627
BspACI CCGC 3 cut(s) 91, 97, 743
BspANI GGCC 2 cut(s) 216, 679
BspLI GGNNCC 1 cut(s) 217
BspOI GCTAGC 1 cut(s) 711
BspT104I TTCGAA 1 cut(s) 225
BspTI CTTAAG 1 cut(s) 455
BsrDI GCAATG 1 cut(s) 738
BsrGI TGTACA 1 cut(s) 627
BsrI ACTGG 2 cut(s) 170, 403
BssECI CCNNGG 2 cut(s) 271, 680
BssNI GRCGYC 1 cut(s) 596
Bst4CI ACNGT 3 cut(s) 73, 358, 580
Bst6I CTCTTC 1 cut(s) 83
BstACI GRCGYC 1 cut(s) 596
BstAFI CTTAAG 1 cut(s) 455
BstAUI TGTACA 1 cut(s) 627
BstBAI YACGTR 1 cut(s) 343
BstBI TTCGAA 1 cut(s) 225
BstC8I GCNNGC 4 cut(s) 709, 733, 778, 782
BstDEI CTNAG 3 cut(s) 8, 101, 146
BstF5I GGATG 3 cut(s) 203, 352, 376
BstHHI GCGC 2 cut(s) 260, 641
BstMAI GTCTC 1 cut(s) 156
BstMWI GCNNNNNNNGC 4 cut(s) 451, 661, 728, 757
BstNSI RCATGY 1 cut(s) 445
BstSFI CTRYAG 1 cut(s) 752
BstV1I GCAGC 7 cut(s) 623, 645, 648, 722, 735, 760, 772
BstV2I GAAGAC 1 cut(s) 234
BsuRI GGCC 2 cut(s) 216, 679
BtsCI GGATG 3 cut(s) 203, 352, 376
BtsI GCAGTG 2 cut(s) 423, 770
BtsIMutI CAGTG 3 cut(s) 354, 423, 770
Cac8I GCNNGC 4 cut(s) 709, 733, 778, 782
CaiI CAGNNNCTG 1 cut(s) 636
CfoI GCGC 2 cut(s) 260, 641
Cfr13I GGNCC 1 cut(s) 215
CseI GACGC 1 cut(s) 585
Csp6I GTAC 3 cut(s) 340, 352, 628
CspCI CAANNNNNGTGG 2 cut(s) 175, 210
CviAII CATG 2 cut(s) 425, 442
CviQI GTAC 3 cut(s) 340, 352, 628
DdeI CTNAG 3 cut(s) 8, 101, 146
DraI TTTAAA 1 cut(s) 328
EaeI YGGCCR 1 cut(s) 677
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
EciI GGCGGA 2 cut(s) 80, 86
Eco24I GRGCYC 1 cut(s) 186
Eco57I CTGAAG 2 cut(s) 686, 737
Eco88I CYCGRG 1 cut(s) 482
EcoO109I RGGNCCY 1 cut(s) 215
EcoT38I GRGCYC 1 cut(s) 186
FaeI CATG 2 cut(s) 428, 445
FaiI YATR 6 cut(s) 298, 383, 426, 443, 452, 510
FatI CATG 2 cut(s) 424, 441
Fnu4HI GCNGC 8 cut(s) 634, 637, 662, 736, 749, 761, 774, 785
FokI GGATG 3 cut(s) 210, 359, 383
FriOI GRGCYC 1 cut(s) 186
Fsp4HI GCNGC 8 cut(s) 634, 637, 662, 736, 749, 761, 774, 785
FspBI CTAG 3 cut(s) 204, 611, 708
FspI TGCGCA 1 cut(s) 640
GlaI GCGC 2 cut(s) 259, 640
GluI GCNGC 8 cut(s) 634, 637, 662, 736, 749, 761, 774, 785
HaeIII GGCC 2 cut(s) 216, 679
HgaI GACGC 1 cut(s) 585
HhaI GCGC 2 cut(s) 260, 641
Hin1I GRCGYC 1 cut(s) 596
Hin1II CATG 2 cut(s) 428, 445
Hin6I GCGC 2 cut(s) 258, 639
HinP1I GCGC 2 cut(s) 258, 639
HincII GTYRAC 1 cut(s) 727
HindII GTYRAC 1 cut(s) 727
HinfI GANTC 3 cut(s) 4, 233, 283
HphI GGTGA 2 cut(s) 130, 634
Hpy166II GTNNAC 2 cut(s) 354, 727
Hpy188I TCNGA 5 cut(s) 9, 58, 238, 272, 717
Hpy188III TCNNGA 3 cut(s) 204, 433, 611
Hpy8I GTNNAC 2 cut(s) 354, 727
Hpy99I CGWCG 1 cut(s) 601
HpyAV CCTTC 7 cut(s) 95, 129, 462, 515, 608, 661, 712
HpyCH4III ACNGT 3 cut(s) 73, 358, 580
HpyCH4IV ACGT 1 cut(s) 342
HpyCH4V TGCA 4 cut(s) 64, 738, 768, 776
HpyF10VI GCNNNNNNNGC 4 cut(s) 451, 661, 728, 757
HpyF3I CTNAG 3 cut(s) 8, 101, 146
HpySE526I ACGT 1 cut(s) 342
Hsp92I GRCGYC 1 cut(s) 596
Hsp92II CATG 2 cut(s) 428, 445
HspAI GCGC 2 cut(s) 258, 639
LmnI GCTCC 1 cut(s) 238
LpnPI CCDG 5 cut(s) 151, 384, 446, 740, 766
Lsp1109I GCAGC 7 cut(s) 623, 645, 648, 722, 735, 760, 772
MaeI CTAG 3 cut(s) 204, 611, 708
MaeII ACGT 1 cut(s) 342
MaeIII GTNAC 1 cut(s) 394
MboII GAAGA 7 cut(s) 70, 73, 239, 484, 502, 526, 656
MhlI GDGCHC 1 cut(s) 186
MluCI AATT 3 cut(s) 59, 277, 330
MroXI GAANNNNTTC 1 cut(s) 287
MseI TTAA 3 cut(s) 327, 456, 501
MslI CAYNNNNRTG 1 cut(s) 743
MspA1I CMGCKG 1 cut(s) 636
MspCI CTTAAG 1 cut(s) 455
MwoI GCNNNNNNNGC 4 cut(s) 451, 661, 728, 757
NheI GCTAGC 1 cut(s) 707
NlaIII CATG 2 cut(s) 428, 445
NlaIV GGNNCC 1 cut(s) 217
NmeAIII GCCGAG 1 cut(s) 705
NsbI TGCGCA 1 cut(s) 640
NspI RCATGY 1 cut(s) 445
NspV TTCGAA 1 cut(s) 225
PaeR7I CTCGAG 1 cut(s) 482
PdmI GAANNNNTTC 1 cut(s) 287
PfeI GAWTC 3 cut(s) 4, 233, 283
PkrI GCNGC 8 cut(s) 635, 638, 663, 737, 750, 762, 775, 786
Ppu21I YACGTR 1 cut(s) 343
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 1 cut(s) 215
PspXI VCTCGAGB 1 cut(s) 482
PstNI CAGNNNCTG 1 cut(s) 636
PvuII CAGCTG 1 cut(s) 636
RsaI GTAC 3 cut(s) 341, 353, 629
RsaNI GTAC 3 cut(s) 340, 352, 628
RseI CAYNNNNRTG 1 cut(s) 743
SaqAI TTAA 3 cut(s) 327, 456, 501
SatI GCNGC 8 cut(s) 634, 637, 662, 736, 749, 761, 774, 785
Sau96I GGNCC 1 cut(s) 215
SduI GDGCHC 1 cut(s) 186
SetI ASST 9 cut(s) 44, 130, 277, 345, 507, 610, 638, 672, 737
SfcI CTRYAG 1 cut(s) 752
Sfr274I CTCGAG 1 cut(s) 482
SfuI TTCGAA 1 cut(s) 225
SlaI CTCGAG 1 cut(s) 482
SmiMI CAYNNNNRTG 1 cut(s) 743
SmlI CTYRAG 3 cut(s) 455, 482, 539
SmoI CTYRAG 3 cut(s) 455, 482, 539
Sse9I AATT 3 cut(s) 59, 277, 330
SsiI CCGC 3 cut(s) 91, 97, 743
SspMI CTAG 3 cut(s) 204, 611, 708
TaaI ACNGT 3 cut(s) 73, 358, 580
TaiI ACGT 1 cut(s) 345
TaqI TCGA 6 cut(s) 225, 361, 447, 483, 588, 599
TasI AATT 3 cut(s) 59, 277, 330
TatI WGTACW 2 cut(s) 351, 627
TfiI GAWTC 3 cut(s) 4, 233, 283
Tru1I TTAA 3 cut(s) 327, 456, 501
Tru9I TTAA 3 cut(s) 327, 456, 501
TscAI CASTG 3 cut(s) 361, 423, 770
TseI GCWGC 8 cut(s) 633, 636, 661, 735, 748, 760, 773, 784
TspDTI ATGAA 3 cut(s) 17, 492, 497
TspRI CASTG 3 cut(s) 361, 423, 770
Vha464I CTTAAG 1 cut(s) 455
XbaI TCTAGA 2 cut(s) 203, 610
XceI RCATGY 1 cut(s) 445
XhoI CTCGAG 1 cut(s) 482
XmnI GAANNNNTTC 1 cut(s) 287
XspI CTAG 3 cut(s) 204, 611, 708
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.