Rmu_sc0004359.1_g000031

Belongs to the glycosyl hydrolase 17 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004359.1
Physical Location & Seq
Forward (+)
107856 .. 108146
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004359.1_g000031.1.cds

Sequence Viewer

Length: 291 bp
atgaccagcattgttcaatttttagcgtcaaccaattcatctcttatgatcaatgcgtacccttactttgccttcaagtcataccctgccaatgttcacttggactatgctctattcactactaaaacctcggtgattcaagatggaccactcggctactacaacctgttggatgccatagtggattcgttttacacggcaatggagaaagtaggcagccctaatgtcacggttgtggtgtctgaaagtggttggccttctactgggagcggacagttcaccaccccataa

Protein Analysis

96

Amino Acids

10.43

Weight (kDa)

4.52

Isoelectric Point (pI)

25.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019918)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 270
AciI CCGC 1 cut(s) 270
AfaI GTAC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 263
AgsI TTSAA 3 cut(s) 17, 76, 140
AleI CACNNNNGTG 1 cut(s) 233
AoxI GGCC 1 cut(s) 254
ApeKI GCWGC 1 cut(s) 216
AspS9I GGNCC 1 cut(s) 146
AsuHPI GGTGA 2 cut(s) 145, 271
AvaII GGWCC 1 cut(s) 146
BbvI GCAGC 1 cut(s) 228
BccI CCATC 1 cut(s) 137
BceAI ACGGC 1 cut(s) 213
BclI TGATCA 1 cut(s) 48
BisI GCNGC 1 cut(s) 217
BlsI GCNGC 1 cut(s) 218
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmrI ACTGGG 1 cut(s) 273
BmsI GCATC 1 cut(s) 163
BmuI ACTGGG 1 cut(s) 273
BsaJI CCNNGG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 263
Bse1I ACTGG 1 cut(s) 268
Bse3DI GCAATG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 1 cut(s) 263
BseMI GCAATG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 268
BseXI GCAGC 1 cut(s) 228
BshFI GGCC 1 cut(s) 256
BslI CCNNNNNNNGG 1 cut(s) 263
BsnI GGCC 1 cut(s) 256
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 1 cut(s) 270
BspANI GGCC 1 cut(s) 256
BsrBI CCGCTC 1 cut(s) 270
BsrDI GCAATG 1 cut(s) 207
BsrI ACTGG 1 cut(s) 268
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 1 cut(s) 48
Bst4CI ACNGT 2 cut(s) 232, 276
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstV1I GCAGC 1 cut(s) 228
BsuRI GGCC 1 cut(s) 256
BtsCI GGATG 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 146
CseI GACGC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 58
CviJI RGCY 3 cut(s) 156, 219, 256
CviKI_1 RGCY 3 cut(s) 156, 219, 256
CviQI GTAC 1 cut(s) 58
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
Eco47I GGWCC 1 cut(s) 146
FaiI YATR 5 cut(s) 47, 82, 108, 179, 289
FbaI TGATCA 1 cut(s) 48
Fnu4HI GCNGC 1 cut(s) 217
FokI GGATG 1 cut(s) 185
Fsp4HI GCNGC 1 cut(s) 217
GluI GCNGC 1 cut(s) 217
HaeIII GGCC 1 cut(s) 256
HgaI GACGC 1 cut(s) 15
HincII GTYRAC 1 cut(s) 30
HindII GTYRAC 1 cut(s) 30
HinfI GANTC 2 cut(s) 136, 185
HphI GGTGA 2 cut(s) 145, 271
Hpy166II GTNNAC 3 cut(s) 30, 97, 279
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 3 cut(s) 30, 97, 279
HpyAV CCTTC 2 cut(s) 82, 267
HpyCH4III ACNGT 2 cut(s) 232, 276
Ksp22I TGATCA 1 cut(s) 48
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 267
LpnPI CCDG 4 cut(s) 19, 99, 179, 249
Lsp1109I GCAGC 1 cut(s) 228
LweI GCATC 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 226
MalI GATC 1 cut(s) 50
MbiI CCGCTC 1 cut(s) 270
MboI GATC 1 cut(s) 48
MluCI AATT 2 cut(s) 17, 34
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 1 cut(s) 139
MslI CAYNNNNRTG 2 cut(s) 200, 233
NdeII GATC 1 cut(s) 48
NmeAIII GCCGAG 1 cut(s) 132
NmuCI GTSAC 1 cut(s) 226
OliI CACNNNNGTG 1 cut(s) 233
PfeI GAWTC 2 cut(s) 136, 185
PkrI GCNGC 1 cut(s) 218
PspPI GGNCC 1 cut(s) 146
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
RseI CAYNNNNRTG 2 cut(s) 200, 233
SatI GCNGC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 146
SetI ASST 2 cut(s) 131, 168
SfaNI GCATC 1 cut(s) 163
SinI GGWCC 1 cut(s) 146
SmiMI CAYNNNNRTG 2 cut(s) 200, 233
Sse9I AATT 2 cut(s) 17, 34
SsiI CCGC 1 cut(s) 270
TaaI ACNGT 2 cut(s) 232, 276
TasI AATT 2 cut(s) 17, 34
TfiI GAWTC 2 cut(s) 136, 185
TseFI GTSAC 1 cut(s) 226
TseI GCWGC 1 cut(s) 216
Tsp45I GTSAC 1 cut(s) 226
TspDTI ATGAA 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 146
XcmI CCANNNNNNNNNTGG 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.