Rmu_sc0004453.1_g000005

Protein RMD5 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004453.1
Physical Location & Seq
Reverse (-)
22607 .. 22918
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004453.1_g000005.1.cds

Sequence Viewer

Length: 312 bp
atgactatagctgttagggttcaagggctgccacctgttctcaagtttatgaatgtaatggtagggaagagaaatgaatggcagactatgaagcagttgcttgtgccagtgaagttagaccgtgagtttcagttccattctatttttgtttgtctagtctccaaggaacaagcaactgaagaaaatccacctatgttgatgtcatctggacatgtgctttgcaagcagtctatttcaaaggtgtcaaagaacggcactaaaaccttcaaatgtccttactgtcctttcgatatcgattccaggacagtgtag

Protein Analysis

103

Amino Acids

11.75

Weight (kDa)

9.39

Isoelectric Point (pI)

48.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018937)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 198
AflIII ACRYGT 1 cut(s) 211
AgsI TTSAA 3 cut(s) 23, 237, 268
AjnI CCWGG 1 cut(s) 299
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Alw26I GTCTC 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 28
ArsI GACNNNNNNTTYG 2 cut(s) 201, 233
BbvI GCAGC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 268
BciT130I CCWGG 1 cut(s) 301
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 29
BlsI GCNGC 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 301
BpuEI CTTGAG 1 cut(s) 26
Bsa29I ATCGAT 1 cut(s) 294
BsaJI CCNNGG 1 cut(s) 162
Bse1I ACTGG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 301
BseCI ATCGAT 1 cut(s) 294
BseDI CCNNGG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 107
BseXI GCAGC 1 cut(s) 15
BshVI ATCGAT 1 cut(s) 294
BsmAI GTCTC 1 cut(s) 163
BspDI ATCGAT 1 cut(s) 294
BsrI ACTGG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 162
BssT1I CCWWGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 301
Bst4CI ACNGT 3 cut(s) 122, 281, 307
Bst6I CTCTTC 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 224
BstMAI GTCTC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 223
BstNI CCWGG 1 cut(s) 301
BstNSI RCATGY 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 15
Bsu15I ATCGAT 1 cut(s) 294
BsuTUI ATCGAT 1 cut(s) 294
BtsIMutI CAGTG 2 cut(s) 114, 312
Cac8I GCNNGC 1 cut(s) 224
ClaI ATCGAT 1 cut(s) 294
CspCI CAANNNNNGTGG 2 cut(s) 177, 212
CviAII CATG 1 cut(s) 212
CviJI RGCY 2 cut(s) 11, 28
CviKI_1 RGCY 2 cut(s) 11, 28
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
Eco130I CCWWGG 1 cut(s) 162
Eco32I GATATC 1 cut(s) 292
Eco57I CTGAAG 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 299
EcoRV GATATC 1 cut(s) 292
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 1 cut(s) 215
FaiI YATR 5 cut(s) 8, 50, 89, 194, 213
FatI CATG 1 cut(s) 211
Fnu4HI GCNGC 1 cut(s) 29
Fsp4HI GCNGC 1 cut(s) 29
FspBI CTAG 1 cut(s) 155
GluI GCNGC 1 cut(s) 29
Hin1II CATG 1 cut(s) 215
HinfI GANTC 1 cut(s) 296
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 274
HpyCH4III ACNGT 3 cut(s) 122, 281, 307
HpyCH4V TGCA 1 cut(s) 222
HpyF10VI GCNNNNNNNGC 1 cut(s) 223
Hsp92II CATG 1 cut(s) 215
LpnPI CCDG 4 cut(s) 48, 120, 192, 286
Lsp1109I GCAGC 1 cut(s) 15
MaeI CTAG 1 cut(s) 155
MboII GAAGA 2 cut(s) 79, 191
MspR9I CCNGG 1 cut(s) 301
MvaI CCWGG 1 cut(s) 301
MwoI GCNNNNNNNGC 1 cut(s) 223
NlaIII CATG 1 cut(s) 215
NspI RCATGY 1 cut(s) 215
PciI ACATGT 1 cut(s) 211
PfeI GAWTC 1 cut(s) 296
PfoI TCCNGGA 1 cut(s) 299
PkrI GCNGC 1 cut(s) 30
PscI ACATGT 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 299
PspGI CCWGG 1 cut(s) 299
SatI GCNGC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 301
SetI ASST 5 cut(s) 13, 37, 193, 243, 266
SfcI CTRYAG 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
SspMI CTAG 1 cut(s) 155
StyD4I CCNGG 1 cut(s) 299
StyI CCWWGG 1 cut(s) 162
TaaI ACNGT 3 cut(s) 122, 281, 307
TaqI TCGA 2 cut(s) 288, 294
TfiI GAWTC 1 cut(s) 296
TscAI CASTG 2 cut(s) 114, 312
TseI GCWGC 1 cut(s) 28
TspDTI ATGAA 3 cut(s) 65, 90, 104
TspRI CASTG 2 cut(s) 114, 312
XceI RCATGY 1 cut(s) 215
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.