Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004851.1

Orthogroup ID

OG0020745

Physical Location & Seq

Genomic Coordinates Reverse (-)

15290 .. 15736

Gene Structure 447 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 447 bp

atgaatatcatagttggagaggtgggttggtcaactgatggggttgtaaatgccaatatcccaaatgccaaaaggtttgatcagggaatgcttgaacatgccttgagcggaaatggaactccagctagggaaggcatgattgatgtttacctttacagccgcattgatgaaaatgctaaaagcattgctcccgactgctttaagagggattggggcctgttcgagttcgatgggaagctgaaatacgagttggatttggcggcttcagtgcagaataagggaattgtagccgttgaagggatgttcaaaaggtggtgtgtgctgaatccagatgctaaagatttgtatggtttgccaagtagcgttgactatgcttgtggtctttcagattgtcctgccttgggttatggttcttcttgcaataaccatagtgtttctgtggcgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001871 GO:0003674 GO:0003824 GO:0004553 GO:0005488 GO:0005575 GO:0005576 GO:0005623 GO:0005886 GO:0005911 GO:0008150 GO:0009506 GO:0009664 GO:0009987 GO:0016020 GO:0016043 GO:0016787 GO:0016798 GO:0030054 GO:0030246 GO:0030247 GO:0031224 GO:0031225 GO:0031226 GO:0044425 GO:0044459 GO:0044464 GO:0045229 GO:0046658 GO:0048046 GO:0055044 GO:0071554 GO:0071555 GO:0071669 GO:0071840 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00500 map00500

Pfam Domains

Protein Families

Glyco_hydro_17 X8

Protein Analysis

148

Amino Acids

16.04

Weight (kDa)

4.79

Isoelectric Point (pI)

32.18

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Glyco_hydro_17	PF00332	1 - 85	9.9e-15	Glycosyl hydrolases family 17

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020745)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0004851.1_g000005
rosa_roxburghii	Rroxscaffold_2G00150550 Rroxscaffold_2G00150580
rosa_rugosa	Rorug02G0012700
rosa_samantha	Rh2AG058800 Rh2BG057300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	108
AciI	CCGC	3 cut(s)	108, 160, 260
AcuI	CTGAAG	1 cut(s)	249
AfiI	CCNNNNNNNGG	2 cut(s)	297, 401
AgsI	TTSAA	3 cut(s)	95, 296, 307
AjuI	GAANNNNNNNTTGG	2 cut(s)	233, 265
AluBI	AGCT	2 cut(s)	125, 238
AluI	AGCT	2 cut(s)	125, 238
AoxI	GGCC	1 cut(s)	214
AspS9I	GGNCC	1 cut(s)	214
BarI	GAAGNNNNNNTAC	2 cut(s)	227, 259
BccI	CCATC	2 cut(s)	32, 224
BceAI	ACGGC	1 cut(s)	275
BclI	TGATCA	1 cut(s)	79
BfaI	CTAG	1 cut(s)	126
BisI	GCNGC	2 cut(s)	160, 261
BlsI	GCNGC	2 cut(s)	161, 262
BmgT120I	GGNCC	1 cut(s)	214
BmiI	GGNNCC	1 cut(s)	215
BmsI	GCATC	1 cut(s)	322
BpmI	CTGGAG	1 cut(s)	105
BpuEI	CTTGAG	1 cut(s)	124
BsaJI	CCNNGG	1 cut(s)	399
Bsc4I	CCNNNNNNNGG	2 cut(s)	297, 401
Bse3DI	GCAATG	1 cut(s)	183
BseDI	CCNNGG	1 cut(s)	399
BseGI	GGATG	1 cut(s)	306
BseLI	CCNNNNNNNGG	2 cut(s)	297, 401
BseMI	GCAATG	1 cut(s)	183
BsgI	GTGCAG	1 cut(s)	290
BshFI	GGCC	1 cut(s)	216
BslI	CCNNNNNNNGG	2 cut(s)	297, 401
BsmI	GAATGC	1 cut(s)	93
BsnI	GGCC	1 cut(s)	216
Bsp143I	GATC	1 cut(s)	79
BspACI	CCGC	3 cut(s)	108, 160, 260
BspANI	GGCC	1 cut(s)	216
BspLI	GGNNCC	1 cut(s)	215
BsrBI	CCGCTC	1 cut(s)	108
BsrDI	GCAATG	1 cut(s)	183
BssECI	CCNNGG	1 cut(s)	399
BssMI	GATC	1 cut(s)	79
BssT1I	CCWWGG	1 cut(s)	399
BstF5I	GGATG	1 cut(s)	306
BstKTI	GATC	1 cut(s)	82
BstMBI	GATC	1 cut(s)	79
BstNSI	RCATGY	1 cut(s)	101
BsuRI	GGCC	1 cut(s)	216
BtsCI	GGATG	1 cut(s)	306
BtsIMutI	CAGTG	1 cut(s)	273
Cfr13I	GGNCC	1 cut(s)	214
CviAII	CATG	2 cut(s)	98, 136
CviJI	RGCY	6 cut(s)	125, 159, 216, 238, 263, 290
CviKI_1	RGCY	6 cut(s)	125, 159, 216, 238, 263, 290
DpnI	GATC	1 cut(s)	81
DpnII	GATC	1 cut(s)	79
Eco130I	CCWWGG	1 cut(s)	399
Eco57I	CTGAAG	1 cut(s)	249
EcoO109I	RGGNCCY	1 cut(s)	214
EcoT14I	CCWWGG	1 cut(s)	399
ErhI	CCWWGG	1 cut(s)	399
FaeI	CATG	2 cut(s)	101, 139
FaiI	YATR	7 cut(s)	11, 99, 137, 348, 372, 408, 429
FatI	CATG	2 cut(s)	97, 135
FbaI	TGATCA	1 cut(s)	79
Fnu4HI	GCNGC	2 cut(s)	160, 261
FokI	GGATG	1 cut(s)	313
Fsp4HI	GCNGC	2 cut(s)	160, 261
FspBI	CTAG	1 cut(s)	126
GluI	GCNGC	2 cut(s)	160, 261
GsuI	CTGGAG	1 cut(s)	105
HaeIII	GGCC	1 cut(s)	216
Hin1II	CATG	2 cut(s)	101, 139
HincII	GTYRAC	2 cut(s)	33, 367
HindII	GTYRAC	2 cut(s)	33, 367
HinfI	GANTC	1 cut(s)	325
Hpy166II	GTNNAC	3 cut(s)	33, 148, 367
Hpy188I	TCNGA	1 cut(s)	388
Hpy188III	TCNNGA	2 cut(s)	191, 329
Hpy8I	GTNNAC	3 cut(s)	33, 148, 367
HpyAV	CCTTC	2 cut(s)	125, 290
HpyCH4V	TGCA	2 cut(s)	271, 420
Hsp92II	CATG	2 cut(s)	101, 139
Ksp22I	TGATCA	1 cut(s)	79
Kzo9I	GATC	1 cut(s)	79
LmnI	GCTCC	1 cut(s)	193
LpnPI	CCDG	5 cut(s)	68, 135, 230, 342, 408
LweI	GCATC	1 cut(s)	322
MaeI	CTAG	1 cut(s)	126
MalI	GATC	1 cut(s)	81
MbiI	CCGCTC	1 cut(s)	108
MboI	GATC	1 cut(s)	79
MboII	GAAGA	1 cut(s)	405
MluCI	AATT	1 cut(s)	282
MmeI	TCCRAC	1 cut(s)	231
MnlI	CCTC	2 cut(s)	13, 198
MseI	TTAA	1 cut(s)	201
Mva1269I	GAATGC	1 cut(s)	93
NdeII	GATC	1 cut(s)	79
NlaIII	CATG	2 cut(s)	101, 139
NlaIV	GGNNCC	1 cut(s)	215
NspI	RCATGY	1 cut(s)	101
PctI	GAATGC	1 cut(s)	93
PfeI	GAWTC	1 cut(s)	325
PkrI	GCNGC	2 cut(s)	161, 262
PspN4I	GGNNCC	1 cut(s)	215
PspPI	GGNCC	1 cut(s)	214
SaqAI	TTAA	1 cut(s)	201
SatI	GCNGC	2 cut(s)	160, 261
Sau3AI	GATC	1 cut(s)	79
Sau96I	GGNCC	1 cut(s)	214
SetI	ASST	6 cut(s)	24, 77, 127, 153, 240, 314
SfaNI	GCATC	1 cut(s)	322
SmlI	CTYRAG	1 cut(s)	103
SmoI	CTYRAG	1 cut(s)	103
Sse9I	AATT	1 cut(s)	282
SsiI	CCGC	3 cut(s)	108, 160, 260
SspMI	CTAG	1 cut(s)	126
StyI	CCWWGG	1 cut(s)	399
TaqI	TCGA	2 cut(s)	222, 228
TasI	AATT	1 cut(s)	282
TauI	GCSGC	2 cut(s)	162, 263
TfiI	GAWTC	1 cut(s)	325
Tru1I	TTAA	1 cut(s)	201
Tru9I	TTAA	1 cut(s)	201
TscAI	CASTG	1 cut(s)	273
TspDTI	ATGAA	2 cut(s)	17, 183
TspRI	CASTG	1 cut(s)	273
XceI	RCATGY	1 cut(s)	101
XspI	CTAG	1 cut(s)	126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.