Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004926.1

Orthogroup ID

OG0021669

Physical Location & Seq

Genomic Coordinates Reverse (-)

46951 .. 47394

Gene Structure 444 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 444 bp

atggcaaaccacaaatggcaaaccatattcctatttattttcatcaactccgccatggccaaggcagtcacttacagcgtgaccaccttaggagccaaaccagatggcaagaccgactcaactaaggccttcctttctgcatgggctaaagcttgtgcctcggtgcaacccgccgtgatttacgtgccggcagggaggttcttgctccgcaatgccttgttcagcggaccatgcaagaacagccacatcaccttccgcatcgccggcaccctcgttgctccgtccgattaccgggtcatcggaaatgccggtaactggcttctctttctgcacgtcaacggagtcaccatttccggaggaattcttgacggtcaaggcactggtttgtgggcttgcaagaactccggcaagagttgccccacgggagccacggtaagcaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

Glyco_hydro_28

Protein Analysis

147

Amino Acids

15.51

Weight (kDa)

9.78

Isoelectric Point (pI)

27.93

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pect-lyase_RHGA_epim	PF12708	26 - 73	1.4e-09	Rhamnogalacturonase A/epimerase, pectate lyase-like
Glyco_hydro_28	PF00295	52 - 137	2.7e-08	Glycosyl hydrolases family 28

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021669)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0004926.1_g000014 Rmu_sc0008355.1_g000009
rosa_roxburghii	Rroxscaffold_2G00128690
rosa_samantha	Rh2CG262900 Rh2DG265400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	266
AccIII	TCCGGA	1 cut(s)	353
AciI	CCGC	5 cut(s)	51, 171, 208, 225, 256
AcoI	YGGCCR	1 cut(s)	57
AcsI	RAATTY	1 cut(s)	360
AfiI	CCNNNNNNNGG	2 cut(s)	291, 315
AjiI	CACGTC	1 cut(s)	334
AluBI	AGCT	1 cut(s)	152
AluI	AGCT	1 cut(s)	152
Aor13HI	TCCGGA	1 cut(s)	353
AoxI	GGCC	2 cut(s)	57, 126
ApoI	RAATTY	1 cut(s)	360
AspS9I	GGNCC	1 cut(s)	227
AsuC2I	CCSGG	1 cut(s)	293
AsuHPI	GGTGA	2 cut(s)	241, 337
AvaII	GGWCC	1 cut(s)	227
AxyI	CCTNAGG	1 cut(s)	88
BalI	TGGCCA	1 cut(s)	59
BanI	GGYRCC	1 cut(s)	266
BccI	CCATC	1 cut(s)	98
BceAI	ACGGC	1 cut(s)	158
BcnI	CCSGG	1 cut(s)	293
Bme1390I	CCNGG	1 cut(s)	293
Bme18I	GGWCC	1 cut(s)	227
BmgBI	CACGTC	1 cut(s)	334
BmgT120I	GGNCC	1 cut(s)	227
BmiI	GGNNCC	3 cut(s)	94, 268, 427
BmrFI	CCNGG	1 cut(s)	293
BmsI	GCATC	1 cut(s)	267
BpuMI	CCSGG	1 cut(s)	293
BsaAI	YACGTR	1 cut(s)	184
BsaJI	CCNNGG	5 cut(s)	54, 60, 159, 420, 429
BsaWI	WCCGGW	1 cut(s)	353
BsaXI	ACNNNNNCTCC	1 cut(s)	417
Bsc4I	CCNNNNNNNGG	2 cut(s)	291, 315
Bse118I	RCCGGY	3 cut(s)	187, 263, 308
Bse1I	ACTGG	2 cut(s)	320, 385
Bse21I	CCTNAGG	1 cut(s)	88
Bse3DI	GCAATG	1 cut(s)	217
BseAI	TCCGGA	1 cut(s)	353
BseDI	CCNNGG	5 cut(s)	54, 60, 159, 420, 429
BseLI	CCNNNNNNNGG	2 cut(s)	291, 315
BseMI	GCAATG	1 cut(s)	217
BseNI	ACTGG	2 cut(s)	320, 385
BsgI	GTGCAG	1 cut(s)	314
BshFI	GGCC	2 cut(s)	59, 128
BshNI	GGYRCC	1 cut(s)	266
BsiSI	CCGG	6 cut(s)	188, 264, 292, 309, 354, 405
BslI	CCNNNNNNNGG	2 cut(s)	291, 315
BsnI	GGCC	2 cut(s)	59, 128
Bsp13I	TCCGGA	1 cut(s)	353
Bsp19I	CCATGG	1 cut(s)	54
BspACI	CCGC	5 cut(s)	51, 171, 208, 225, 256
BspANI	GGCC	2 cut(s)	59, 128
BspEI	TCCGGA	1 cut(s)	353
BspLI	GGNNCC	3 cut(s)	94, 268, 427
BspT107I	GGYRCC	1 cut(s)	266
BsrDI	GCAATG	1 cut(s)	217
BsrFI	RCCGGY	3 cut(s)	187, 263, 308
BsrI	ACTGG	2 cut(s)	320, 385
BssAI	RCCGGY	3 cut(s)	187, 263, 308
BssECI	CCNNGG	5 cut(s)	54, 60, 159, 420, 429
BssT1I	CCWWGG	2 cut(s)	54, 60
Bst4CI	ACNGT	2 cut(s)	371, 433
BstAPI	GCANNNNNTGC	1 cut(s)	414
BstBAI	YACGTR	1 cut(s)	184
BstC8I	GCNNGC	3 cut(s)	189, 265, 394
BstDEI	CTNAG	2 cut(s)	88, 123
BstDSI	CCRYGG	3 cut(s)	54, 420, 429
BstMWI	GCNNNNNNNGC	4 cut(s)	231, 240, 264, 414
BstSCI	CCNGG	1 cut(s)	291
Bsu36I	CCTNAGG	1 cut(s)	88
BsuRI	GGCC	2 cut(s)	59, 128
BtgI	CCRYGG	3 cut(s)	54, 420, 429
BtgZI	GCGATG	1 cut(s)	244
BtrI	CACGTC	1 cut(s)	334
BtsIMutI	CAGTG	1 cut(s)	378
Cac8I	GCNNGC	3 cut(s)	189, 265, 394
Cfr10I	RCCGGY	3 cut(s)	187, 263, 308
Cfr13I	GGNCC	1 cut(s)	227
CviAII	CATG	3 cut(s)	55, 141, 231
CviJI	RGCY	9 cut(s)	59, 95, 128, 146, 152, 243, 319, 392, 428
CviKI_1	RGCY	9 cut(s)	59, 95, 128, 146, 152, 243, 319, 392, 428
DdeI	CTNAG	2 cut(s)	88, 123
EaeI	YGGCCR	1 cut(s)	57
EciI	GGCGGA	1 cut(s)	40
Eco130I	CCWWGG	2 cut(s)	54, 60
Eco147I	AGGCCT	1 cut(s)	128
Eco47I	GGWCC	1 cut(s)	227
Eco81I	CCTNAGG	1 cut(s)	88
EcoRI	GAATTC	1 cut(s)	360
EcoT14I	CCWWGG	2 cut(s)	54, 60
ErhI	CCWWGG	2 cut(s)	54, 60
FaeI	CATG	3 cut(s)	58, 144, 234
FaiI	YATR	4 cut(s)	26, 56, 142, 232
FatI	CATG	3 cut(s)	54, 140, 230
FauI	CCCGC	1 cut(s)	178
HaeIII	GGCC	2 cut(s)	59, 128
HapII	CCGG	6 cut(s)	188, 264, 292, 309, 354, 405
Hin1II	CATG	3 cut(s)	58, 144, 234
HincII	GTYRAC	1 cut(s)	337
HindII	GTYRAC	1 cut(s)	337
HindIII	AAGCTT	1 cut(s)	150
HinfI	GANTC	2 cut(s)	116, 342
HpaII	CCGG	6 cut(s)	188, 264, 292, 309, 354, 405
HphI	GGTGA	2 cut(s)	241, 337
Hpy166II	GTNNAC	1 cut(s)	337
Hpy188I	TCNGA	2 cut(s)	286, 302
Hpy188III	TCNNGA	2 cut(s)	354, 365
Hpy8I	GTNNAC	1 cut(s)	337
HpyAV	CCTTC	2 cut(s)	139, 262
HpyCH4III	ACNGT	2 cut(s)	371, 433
HpyCH4IV	ACGT	2 cut(s)	183, 333
HpyCH4V	TGCA	5 cut(s)	140, 166, 234, 331, 396
HpyF10VI	GCNNNNNNNGC	4 cut(s)	231, 240, 264, 414
HpyF3I	CTNAG	2 cut(s)	88, 123
HpySE526I	ACGT	2 cut(s)	183, 333
Hsp92II	CATG	3 cut(s)	58, 144, 234
Kpn2I	TCCGGA	1 cut(s)	353
KroI	GCCGGC	2 cut(s)	187, 263
KroNI	GCCGGC	2 cut(s)	189, 265
LmnI	GCTCC	4 cut(s)	92, 210, 283, 425
LweI	GCATC	1 cut(s)	267
MaeII	ACGT	2 cut(s)	183, 333
MaeIII	GTNAC	4 cut(s)	67, 79, 311, 343
MlsI	TGGCCA	1 cut(s)	59
MluCI	AATT	2 cut(s)	360, 439
MluNI	TGGCCA	1 cut(s)	59
MlyI	GAGTC	2 cut(s)	110, 351
MnlI	CCTC	4 cut(s)	169, 189, 281, 350
Mox20I	TGGCCA	1 cut(s)	59
MroI	TCCGGA	1 cut(s)	353
MroNI	GCCGGC	2 cut(s)	187, 263
MscI	TGGCCA	1 cut(s)	59
MseI	TTAA	1 cut(s)	442
Msp20I	TGGCCA	1 cut(s)	59
MspA1I	CMGCKG	1 cut(s)	225
MspI	CCGG	6 cut(s)	188, 264, 292, 309, 354, 405
MspR9I	CCNGG	1 cut(s)	293
MwoI	GCNNNNNNNGC	4 cut(s)	231, 240, 264, 414
NaeI	GCCGGC	2 cut(s)	189, 265
NciI	CCSGG	1 cut(s)	293
NcoI	CCATGG	1 cut(s)	54
NgoMIV	GCCGGC	2 cut(s)	187, 263
NlaIII	CATG	3 cut(s)	58, 144, 234
NlaIV	GGNNCC	3 cut(s)	94, 268, 427
NmuCI	GTSAC	3 cut(s)	67, 79, 343
PceI	AGGCCT	1 cut(s)	128
PdiI	GCCGGC	2 cut(s)	189, 265
PleI	GAGTC	2 cut(s)	110, 350
PpsI	GAGTC	2 cut(s)	110, 350
Ppu21I	YACGTR	1 cut(s)	184
PspN4I	GGNNCC	3 cut(s)	94, 268, 427
PspPI	GGNCC	1 cut(s)	227
SaqAI	TTAA	1 cut(s)	442
Sau96I	GGNCC	1 cut(s)	227
SchI	GAGTC	2 cut(s)	110, 351
ScrFI	CCNGG	1 cut(s)	293
SetI	ASST	6 cut(s)	89, 154, 186, 200, 254, 336
SfaNI	GCATC	1 cut(s)	267
SinI	GGWCC	1 cut(s)	227
Sse9I	AATT	2 cut(s)	360, 439
SseBI	AGGCCT	1 cut(s)	128
SsiI	CCGC	5 cut(s)	51, 171, 208, 225, 256
StuI	AGGCCT	1 cut(s)	128
StyD4I	CCNGG	1 cut(s)	291
StyI	CCWWGG	2 cut(s)	54, 60
TaaI	ACNGT	2 cut(s)	371, 433
TaiI	ACGT	2 cut(s)	186, 336
TaqII	GACCGA	1 cut(s)	128
TasI	AATT	2 cut(s)	360, 439
Tru1I	TTAA	1 cut(s)	442
Tru9I	TTAA	1 cut(s)	442
TscAI	CASTG	1 cut(s)	385
TseFI	GTSAC	3 cut(s)	67, 79, 343
Tsp45I	GTSAC	3 cut(s)	67, 79, 343
TspDTI	ATGAA	1 cut(s)	31
TspGWI	ACGGA	2 cut(s)	270, 354
TspRI	CASTG	1 cut(s)	385
VpaK11BI	GGWCC	1 cut(s)	227
XapI	RAATTY	1 cut(s)	360

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.