Rmu_sc0005237.1_g000020

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005237.1
OG0021454
Physical Location & Seq
Reverse (-)
61240 .. 62041
802 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005237.1_g000020.1.cds

Sequence Viewer

Length: 561 bp
atggttcggccaatcttttacaaagtggatccatcggacgtaagacaccaaagaggcacatttggtgaggcacttgcagagcatgaacgcatattcaaagatgacagaataaacaaggtgttaagctggagaacagctctttcagaagcagcaaatttatctgggtggcatttctcgggcaggcatgaatatgaatctaaatttatcgatagaatcattaaagagatttctgcacaagtaataaaacatacccctttgaatgtggcaaagtttccagccgggatagaatctcgtgtacaagacatgcttgaactcttagatgtcgggggaagtgatgtacgcatggtagggatatggggaagtggtggaatagggaagacaacaattgctaaagctgtttacaattcaattgctaatgagtttgaagatagttgctttttggcaaatgttagagaaggttcagagcaacatggaggtttagtcaacctacaaaacatcattctttcaaagattctaggaggcaaagaactgatgataaggacctctcggaggactgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

186

Amino Acids

20.82

Weight (kDa)

7.91

Isoelectric Point (pI)

36.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021454)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0262671 RchiOBHm_Chr6g0262841
rosa_multiflora Rmu_sc0005237.1_g000020
rosa_roxburghii Rroxscaffold_7G00207680
rosa_wichuraiana Rw6G009780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 23, 36
AcoI YGGCCR 1 cut(s) 8
AcsI RAATTY 2 cut(s) 154, 200
AfaI GTAC 2 cut(s) 297, 339
AfiI CCNNNNNNNGG 1 cut(s) 549
AgsI TTSAA 6 cut(s) 97, 259, 311, 408, 425, 507
AluBI AGCT 3 cut(s) 126, 137, 395
AluI AGCT 3 cut(s) 126, 137, 395
AlwI GGATC 2 cut(s) 23, 36
Ama87I CYCGRG 1 cut(s) 175
AoxI GGCC 1 cut(s) 8
ApeKI GCWGC 1 cut(s) 149
ApoI RAATTY 2 cut(s) 154, 200
AspS9I GGNCC 1 cut(s) 540
AsuC2I CCSGG 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 77
AvaI CYCGRG 1 cut(s) 175
AvaII GGWCC 1 cut(s) 540
BamHI GGATCC 1 cut(s) 28
BauI CACGAG 1 cut(s) 291
BbsI GAAGAC 1 cut(s) 383
BbvI GCAGC 1 cut(s) 161
BccI CCATC 1 cut(s) 40
BcnI CCSGG 1 cut(s) 280
BfaI CTAG 1 cut(s) 515
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 280
Bme18I GGWCC 1 cut(s) 540
BmeT110I CYCGRG 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 540
BmiI GGNNCC 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 280
BpiI GAAGAC 1 cut(s) 383
BplI GAGNNNNNCTC 2 cut(s) 121, 153
BpmI CTGGAG 1 cut(s) 148
BpuMI CCSGG 1 cut(s) 280
Bsa29I ATCGAT 1 cut(s) 207
BsaXI ACNNNNNCTCC 2 cut(s) 465, 495
Bsc4I CCNNNNNNNGG 1 cut(s) 549
BseCI ATCGAT 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 549
BseXI GCAGC 1 cut(s) 161
BsgI GTGCAG 1 cut(s) 216
BshFI GGCC 1 cut(s) 10
BshVI ATCGAT 1 cut(s) 207
BsiHKCI CYCGRG 1 cut(s) 175
BsiSI CCGG 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 549
BsnI GGCC 1 cut(s) 10
BsoBI CYCGRG 1 cut(s) 175
Bsp1407I TGTACA 1 cut(s) 295
Bsp143I GATC 1 cut(s) 28
BspANI GGCC 1 cut(s) 10
BspDI ATCGAT 1 cut(s) 207
BspLI GGNNCC 1 cut(s) 30
BspPI GGATC 2 cut(s) 23, 36
BsrGI TGTACA 1 cut(s) 295
BssMI GATC 1 cut(s) 28
BssSI CACGAG 1 cut(s) 291
Bst2BI CACGAG 1 cut(s) 291
BstAUI TGTACA 1 cut(s) 295
BstC8I GCNNGC 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 316
BstENI CCTNNNNNAGG 1 cut(s) 547
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstNSI RCATGY 1 cut(s) 307
BstSCI CCNGG 1 cut(s) 278
BstV1I GCAGC 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 383
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
Bsu15I ATCGAT 1 cut(s) 207
BsuRI GGCC 1 cut(s) 10
BsuTUI ATCGAT 1 cut(s) 207
Cac8I GCNNGC 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 540
ClaI ATCGAT 1 cut(s) 207
Csp6I GTAC 2 cut(s) 296, 338
CviAII CATG 5 cut(s) 83, 185, 304, 343, 470
CviJI RGCY 5 cut(s) 10, 126, 137, 278, 395
CviKI_1 RGCY 5 cut(s) 10, 126, 137, 278, 395
CviQI GTAC 2 cut(s) 296, 338
DdeI CTNAG 1 cut(s) 316
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EaeI YGGCCR 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 540
Eco88I CYCGRG 1 cut(s) 175
EcoNI CCTNNNNNAGG 1 cut(s) 547
EcoO109I RGGNCCY 1 cut(s) 540
FaeI CATG 5 cut(s) 86, 188, 307, 346, 473
FaiI YATR 9 cut(s) 84, 92, 186, 192, 249, 305, 344, 355, 471
FalI AAGNNNNNCTT 2 cut(s) 291, 323
FatI CATG 5 cut(s) 82, 184, 303, 342, 469
Fnu4HI GCNGC 1 cut(s) 150
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 515
GluI GCNGC 1 cut(s) 150
GsuI CTGGAG 1 cut(s) 148
HaeIII GGCC 1 cut(s) 10
HapII CCGG 1 cut(s) 279
Hin1II CATG 5 cut(s) 86, 188, 307, 346, 473
HincII GTYRAC 1 cut(s) 484
HindII GTYRAC 1 cut(s) 484
HinfI GANTC 4 cut(s) 194, 213, 287, 511
HpaII CCGG 1 cut(s) 279
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 3 cut(s) 296, 400, 484
Hpy188I TCNGA 4 cut(s) 37, 145, 463, 549
Hpy8I GTNNAC 3 cut(s) 296, 400, 484
HpyAV CCTTC 1 cut(s) 449
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 77, 233
HpyF3I CTNAG 1 cut(s) 316
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 5 cut(s) 86, 188, 307, 346, 473
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 112, 147, 166, 288, 292
Lsp1109I GCAGC 1 cut(s) 161
MaeI CTAG 1 cut(s) 515
MaeII ACGT 1 cut(s) 39
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 2 cut(s) 388, 437
MfeI CAATTG 2 cut(s) 384, 408
MflI RGATCY 1 cut(s) 28
MluCI AATT 5 cut(s) 154, 200, 384, 403, 408
MnlI CCTC 6 cut(s) 47, 61, 467, 512, 543, 553
MseI TTAA 2 cut(s) 122, 219
MslI CAYNNNNRTG 1 cut(s) 189
MspI CCGG 1 cut(s) 279
MspR9I CCNGG 1 cut(s) 280
MunI CAATTG 2 cut(s) 384, 408
NciI CCSGG 1 cut(s) 280
NdeII GATC 1 cut(s) 28
NlaIII CATG 5 cut(s) 86, 188, 307, 346, 473
NlaIV GGNNCC 1 cut(s) 30
NspI RCATGY 1 cut(s) 307
PfeI GAWTC 4 cut(s) 194, 213, 287, 511
PkrI GCNGC 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 540
Psp5II RGGWCCY 1 cut(s) 540
PspN4I GGNNCC 1 cut(s) 30
PspPI GGNCC 1 cut(s) 540
PspPPI RGGWCCY 1 cut(s) 540
PsuI RGATCY 1 cut(s) 28
RsaI GTAC 2 cut(s) 297, 339
RsaNI GTAC 2 cut(s) 296, 338
RseI CAYNNNNRTG 1 cut(s) 189
SaqAI TTAA 2 cut(s) 122, 219
SatI GCNGC 1 cut(s) 150
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 540
ScrFI CCNGG 1 cut(s) 280
SetI ASST 9 cut(s) 42, 120, 128, 139, 397, 460, 478, 489, 545
SinI GGWCC 1 cut(s) 540
SmiMI CAYNNNNRTG 1 cut(s) 189
Sse9I AATT 5 cut(s) 154, 200, 384, 403, 408
SspMI CTAG 1 cut(s) 515
StyD4I CCNGG 1 cut(s) 278
TaiI ACGT 1 cut(s) 42
TaqI TCGA 1 cut(s) 207
TasI AATT 5 cut(s) 154, 200, 384, 403, 408
TatI WGTACW 1 cut(s) 295
TfiI GAWTC 4 cut(s) 194, 213, 287, 511
Tru1I TTAA 2 cut(s) 122, 219
Tru9I TTAA 2 cut(s) 122, 219
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 3 cut(s) 99, 201, 207
VpaK11BI GGWCC 1 cut(s) 540
XagI CCTNNNNNAGG 1 cut(s) 547
XapI RAATTY 2 cut(s) 154, 200
XceI RCATGY 1 cut(s) 307
XspI CTAG 1 cut(s) 515
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.