Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005420.1

Orthogroup ID

OG0021136

Physical Location & Seq

Genomic Coordinates Reverse (-)

59603 .. 60281

Gene Structure 679 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005420.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atgatgtcctacactcctacatttgatggggttcaggattttgtctctcgtgctgaaaagatccttcctaagcataagtatgtcaaattcttgtcacagacagccatcctggagttcaaatgtgggaatccagagagagggcgatccacgtttgaaaatattttgaggcaaaacccgaagagaacagacttgtggagtgtttatcttgatcaagaaattcgacttggagatactgatctgattcgtgcattgtttgagagggcaactagtttgagcctaccagctaaaaagatgaaattcttgttcaaaaaatatctggaatatgaggagcgtcacggtaacgaagagagggccaattacgtgaaacagaaggcaatgagttatgttgagaatacagtagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000460 GO:0000462 GO:0000466 GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005730 GO:0005886 GO:0006139 GO:0006364 GO:0006396 GO:0006725 GO:0006807 GO:0007275 GO:0008134 GO:0008150 GO:0008152 GO:0009553 GO:0009987 GO:0010467 GO:0016020 GO:0016070 GO:0016072 GO:0022613 GO:0030490 GO:0030684 GO:0031974 GO:0031981 GO:0032040 GO:0032501 GO:0032502 GO:0032991 GO:0034470 GO:0034641 GO:0034660 GO:0042254 GO:0042274 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044085 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046483 GO:0048229 GO:0048856 GO:0070013 GO:0071704 GO:0071840 GO:0071944 GO:0090304 GO:0097159 GO:1901360 GO:1901363 GO:1990904

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

S1 Suf

Protein Analysis

134

Amino Acids

15.79

Weight (kDa)

9.3

Isoelectric Point (pI)

51.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021136)

Species	Orthologous Gene IDs
malus_domestica	MD14G1049800.v1.1
prunus_persica	Prupe.7G085700_v2.0.a1
pyrus_communis	pycom14g04120
rosa_laevigata	RLG00000023636
rosa_multiflora	Rmu_sc0005420.1_g000010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	55, 138
AcsI	RAATTY	3 cut(s)	86, 216, 296
AfiI	CCNNNNNNNGG	1 cut(s)	137
AgsI	TTSAA	3 cut(s)	118, 155, 307
AhlI	ACTAGT	1 cut(s)	266
AjnI	CCWGG	1 cut(s)	108
AjuI	GAANNNNNNNTTGG	2 cut(s)	207, 239
AluBI	AGCT	2 cut(s)	284, 401
AluI	AGCT	2 cut(s)	284, 401
Alw26I	GTCTC	1 cut(s)	49
AlwI	GGATC	2 cut(s)	55, 138
AoxI	GGCC	1 cut(s)	351
ApoI	RAATTY	3 cut(s)	86, 216, 296
AspS9I	GGNCC	1 cut(s)	351
BauI	CACGAG	1 cut(s)	48
BccI	CCATC	2 cut(s)	20, 113
BciT130I	CCWGG	1 cut(s)	110
BclI	TGATCA	1 cut(s)	208
BcoDI	GTCTC	1 cut(s)	49
BcuI	ACTAGT	1 cut(s)	266
BfaI	CTAG	1 cut(s)	267
Bme1390I	CCNGG	1 cut(s)	110
BmgT120I	GGNCC	1 cut(s)	351
BmrFI	CCNGG	1 cut(s)	110
BpmI	CTGGAG	1 cut(s)	131
Bpu10I	CCTNAGC	1 cut(s)	69
BsaAI	YACGTR	1 cut(s)	361
BsaBI	GATNNNNATC	1 cut(s)	234
Bsc4I	CCNNNNNNNGG	1 cut(s)	137
Bse3DI	GCAATG	1 cut(s)	381
Bse8I	GATNNNNATC	1 cut(s)	234
BseBI	CCWGG	1 cut(s)	110
BseGI	GGATG	1 cut(s)	105
BseJI	GATNNNNATC	1 cut(s)	234
BseLI	CCNNNNNNNGG	1 cut(s)	137
BseMI	GCAATG	1 cut(s)	381
BseRI	GAGGAG	1 cut(s)	341
BshFI	GGCC	1 cut(s)	353
BslI	CCNNNNNNNGG	1 cut(s)	137
BsmAI	GTCTC	1 cut(s)	49
BsnI	GGCC	1 cut(s)	353
Bsp143I	GATC	4 cut(s)	60, 143, 208, 235
BspANI	GGCC	1 cut(s)	353
BspPI	GGATC	2 cut(s)	55, 138
BsrDI	GCAATG	1 cut(s)	381
BssMI	GATC	4 cut(s)	60, 143, 208, 235
BssSI	CACGAG	1 cut(s)	48
Bst2BI	CACGAG	1 cut(s)	48
Bst2UI	CCWGG	1 cut(s)	110
Bst4CI	ACNGT	2 cut(s)	338, 397
Bst6I	CTCTTC	2 cut(s)	173, 339
BstBAI	YACGTR	1 cut(s)	361
BstDEI	CTNAG	1 cut(s)	69
BstF5I	GGATG	1 cut(s)	105
BstKTI	GATC	4 cut(s)	63, 146, 211, 238
BstMAI	GTCTC	1 cut(s)	49
BstMBI	GATC	4 cut(s)	60, 143, 208, 235
BstNI	CCWGG	1 cut(s)	110
BstSCI	CCNGG	1 cut(s)	108
BstX2I	RGATCY	1 cut(s)	60
BstYI	RGATCY	1 cut(s)	60
BsuRI	GGCC	1 cut(s)	353
BtsCI	GGATG	1 cut(s)	105
Cfr13I	GGNCC	1 cut(s)	351
CseI	GACGC	1 cut(s)	320
CviJI	RGCY	5 cut(s)	104, 276, 284, 353, 401
CviKI_1	RGCY	5 cut(s)	104, 276, 284, 353, 401
DdeI	CTNAG	1 cut(s)	69
DpnI	GATC	4 cut(s)	62, 145, 210, 237
DpnII	GATC	4 cut(s)	60, 143, 208, 235
Eam1104I	CTCTTC	2 cut(s)	173, 339
EarI	CTCTTC	2 cut(s)	173, 339
EcoRII	CCWGG	1 cut(s)	108
FaiI	YATR	4 cut(s)	75, 81, 324, 384
FbaI	TGATCA	1 cut(s)	208
FokI	GGATG	1 cut(s)	92
FspBI	CTAG	1 cut(s)	267
GsuI	CTGGAG	1 cut(s)	131
HaeIII	GGCC	1 cut(s)	353
HgaI	GACGC	1 cut(s)	320
HinfI	GANTC	2 cut(s)	127, 241
Hpy188I	TCNGA	1 cut(s)	240
Hpy188III	TCNNGA	5 cut(s)	35, 131, 206, 212, 317
HpyAV	CCTTC	2 cut(s)	74, 364
HpyCH4III	ACNGT	2 cut(s)	338, 397
HpyCH4IV	ACGT	2 cut(s)	149, 360
HpyCH4V	TGCA	1 cut(s)	248
HpyF3I	CTNAG	1 cut(s)	69
HpySE526I	ACGT	2 cut(s)	149, 360
Ksp22I	TGATCA	1 cut(s)	208
Kzo9I	GATC	4 cut(s)	60, 143, 208, 235
LmnI	GCTCC	1 cut(s)	328
LpnPI	CCDG	6 cut(s)	20, 95, 122, 144, 294, 302
MaeI	CTAG	1 cut(s)	267
MaeII	ACGT	2 cut(s)	149, 360
MaeIII	GTNAC	3 cut(s)	93, 332, 338
MalI	GATC	4 cut(s)	62, 145, 210, 237
MboI	GATC	4 cut(s)	60, 143, 208, 235
MboII	GAAGA	2 cut(s)	190, 356
MflI	RGATCY	1 cut(s)	60
MluCI	AATT	4 cut(s)	86, 216, 296, 355
MnlI	CCTC	5 cut(s)	131, 159, 252, 319, 342
MslI	CAYNNNNRTG	1 cut(s)	78
MspR9I	CCNGG	1 cut(s)	110
MvaI	CCWGG	1 cut(s)	110
NdeII	GATC	4 cut(s)	60, 143, 208, 235
NmuCI	GTSAC	2 cut(s)	93, 332
PfeI	GAWTC	2 cut(s)	127, 241
PfoI	TCCNGGA	1 cut(s)	108
Ppu21I	YACGTR	1 cut(s)	361
Psp6I	CCWGG	1 cut(s)	108
PspGI	CCWGG	1 cut(s)	108
PspPI	GGNCC	1 cut(s)	351
PsuI	RGATCY	1 cut(s)	60
RseI	CAYNNNNRTG	1 cut(s)	78
Sau3AI	GATC	4 cut(s)	60, 143, 208, 235
Sau96I	GGNCC	1 cut(s)	351
ScrFI	CCNGG	1 cut(s)	110
SetI	ASST	4 cut(s)	152, 286, 363, 403
SmiMI	CAYNNNNRTG	1 cut(s)	78
SpeI	ACTAGT	1 cut(s)	266
Sse9I	AATT	4 cut(s)	86, 216, 296, 355
SspI	AATATT	1 cut(s)	160
SspMI	CTAG	1 cut(s)	267
StyD4I	CCNGG	1 cut(s)	108
TaaI	ACNGT	2 cut(s)	338, 397
TaiI	ACGT	2 cut(s)	152, 363
TaqI	TCGA	1 cut(s)	220
TasI	AATT	4 cut(s)	86, 216, 296, 355
TfiI	GAWTC	2 cut(s)	127, 241
TseFI	GTSAC	2 cut(s)	93, 332
Tsp45I	GTSAC	2 cut(s)	93, 332
TspDTI	ATGAA	1 cut(s)	308
XapI	RAATTY	3 cut(s)	86, 216, 296
XspI	CTAG	1 cut(s)	267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.