Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006214.1

Orthogroup ID

OG0016482

Physical Location & Seq

Genomic Coordinates Reverse (-)

55554 .. 57507

Gene Structure 1954 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006214.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 450 bp

atggccgagcagctaacggaggagcagatcgccgagttcaaggaagccttttgcctctttgacaaggacggcgatggctgcatcaccaccaaagaattggggactgtgatgagatctctgggacaaaatcccactgaagctgaattgcaagacatgatcaatgaggttgatgctgaccagaatggcacaattgatttttctgaattcttgaatttgatggcaaggaagatgaaggatactgattctgaggaggaactaaaggaagctttcaaggtgtttgataaggatcagaatggctatatttctgctgcagagcttcgacatgtaatggcaaaccttggagagaaactgaccgatgaagaagtggatgagatgattcgcgaagcagatgaagatggtgatggccaggtgaactatgacgagtttgtcaggatgatgcttaacaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 ko04015 ko04016 ko04020 ko04022 ko04024 ko04070 ko04114 ko04218 ko04261 ko04270 ko04371 ko04626 ko04713 ko04720 ko04722 ko04728 ko04740 ko04744 ko04745 ko04750 ko04910 ko04912 ko04915 ko04916 ko04921 ko04922 ko04924 ko04925 ko04970 ko04971 ko05010 ko05031 ko05034 ko05133 ko05152 ko05167 ko05200 ko05214 ko05418 map04014 map04015 map04016 map04020 map04022 map04024 map04070 map04114 map04218 map04261 map04270 map04371 map04626 map04713 map04720 map04722 map04728 map04740 map04744 map04745 map04750 map04910 map04912 map04915 map04916 map04921 map04922 map04924 map04925 map04970 map04971 map05010 map05031 map05034 map05133 map05152 map05167 map05200 map05214 map05418

Pfam Domains

Protein Families

EF-hand_1

Protein Analysis

149

Amino Acids

17.0

Weight (kDa)

4.12

Isoelectric Point (pI)

33.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016482)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g17810
malus_domestica	MD06G1234300.v1.1 MD14G1241000.v1.1
prunus_persica	Prupe.5G238800_v2.0.a1
pyrus_communis	pycom06g20900 pycom14g20250
rosa_chinensis	RchiOBHm_Chr7g0177771
rosa_laevigata	RLG00000005505
rosa_multiflora	Rmu_sc0006214.1_g000014
rosa_roxburghii	Rroxscaffold_3G00275570
rosa_rugosa	Rorug06G0409400
rosa_samantha	Rh7AG009000 Rh7BG009100 Rh7DG009100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	425
AccII	CGCG	1 cut(s)	381
AclWI	GGATC	1 cut(s)	294
AcoI	YGGCCR	2 cut(s)	3, 403
AcsI	RAATTY	2 cut(s)	203, 211
AcuI	CTGAAG	1 cut(s)	156
AflIII	ACRYGT	1 cut(s)	322
AgsI	TTSAA	3 cut(s)	40, 211, 271
AjnI	CCWGG	1 cut(s)	405
AluBI	AGCT	4 cut(s)	13, 140, 266, 316
AluI	AGCT	4 cut(s)	13, 140, 266, 316
AlwI	GGATC	1 cut(s)	294
AoxI	GGCC	2 cut(s)	3, 403
ApeKI	GCWGC	3 cut(s)	10, 78, 308
ApoI	RAATTY	2 cut(s)	203, 211
AsuHPI	GGTGA	3 cut(s)	76, 410, 421
BalI	TGGCCA	1 cut(s)	405
BbvI	GCAGC	3 cut(s)	22, 65, 295
BccI	CCATC	4 cut(s)	68, 211, 389, 395
BceAI	ACGGC	1 cut(s)	85
BciT130I	CCWGG	1 cut(s)	407
BciVI	GTATCC	1 cut(s)	229
BclI	TGATCA	1 cut(s)	156
BfmI	CTRYAG	1 cut(s)	309
BfuI	GTATCC	1 cut(s)	229
BglII	AGATCT	1 cut(s)	113
BisI	GCNGC	3 cut(s)	11, 79, 309
BlsI	GCNGC	3 cut(s)	12, 80, 310
Bme1390I	CCNGG	1 cut(s)	407
BmrFI	CCNGG	1 cut(s)	407
BmsI	GCATC	3 cut(s)	90, 160, 426
BsaBI	GATNNNNATC	1 cut(s)	285
BsaJI	CCNNGG	1 cut(s)	337
Bse8I	GATNNNNATC	1 cut(s)	285
BseBI	CCWGG	1 cut(s)	407
BseDI	CCNNGG	1 cut(s)	337
BseGI	GGATG	2 cut(s)	373, 438
BseJI	GATNNNNATC	1 cut(s)	285
BseMII	CTCAG	1 cut(s)	237
BseRI	GAGGAG	2 cut(s)	35, 263
BseXI	GCAGC	3 cut(s)	22, 65, 295
Bsh1236I	CGCG	1 cut(s)	381
BshFI	GGCC	2 cut(s)	5, 405
BslFI	GGGAC	2 cut(s)	115, 135
BsmFI	GGGAC	2 cut(s)	115, 135
BsnI	GGCC	2 cut(s)	5, 405
Bsp143I	GATC	4 cut(s)	27, 113, 156, 286
Bsp68I	TCGCGA	1 cut(s)	381
BspANI	GGCC	2 cut(s)	5, 405
BspCNI	CTCAG	1 cut(s)	238
BspFNI	CGCG	1 cut(s)	381
BspMAI	CTGCAG	1 cut(s)	313
BspPI	GGATC	1 cut(s)	294
BssECI	CCNNGG	1 cut(s)	337
BssMI	GATC	4 cut(s)	27, 113, 156, 286
BssT1I	CCWWGG	1 cut(s)	337
Bst2UI	CCWGG	1 cut(s)	407
Bst4CI	ACNGT	1 cut(s)	106
BstDEI	CTNAG	1 cut(s)	246
BstF5I	GGATG	2 cut(s)	373, 438
BstFNI	CGCG	1 cut(s)	381
BstKTI	GATC	4 cut(s)	30, 116, 159, 289
BstMBI	GATC	4 cut(s)	27, 113, 156, 286
BstMWI	GCNNNNNNNGC	1 cut(s)	78
BstNI	CCWGG	1 cut(s)	407
BstNSI	RCATGY	1 cut(s)	326
BstSCI	CCNGG	1 cut(s)	405
BstSFI	CTRYAG	1 cut(s)	309
BstUI	CGCG	1 cut(s)	381
BstV1I	GCAGC	3 cut(s)	22, 65, 295
BstX2I	RGATCY	1 cut(s)	113
BstXI	CCANNNNNNTGG	1 cut(s)	97
BstYI	RGATCY	1 cut(s)	113
BsuI	GTATCC	1 cut(s)	229
BsuRI	GGCC	2 cut(s)	5, 405
BtgZI	GCGATG	1 cut(s)	87
BtsCI	GGATG	2 cut(s)	373, 438
BtsIMutI	CAGTG	1 cut(s)	132
BtuMI	TCGCGA	1 cut(s)	381
CviAII	CATG	2 cut(s)	154, 323
CviJI	RGCY	9 cut(s)	5, 13, 47, 78, 140, 266, 297, 316, 405
CviKI_1	RGCY	9 cut(s)	5, 13, 47, 78, 140, 266, 297, 316, 405
DdeI	CTNAG	1 cut(s)	246
DpnI	GATC	4 cut(s)	29, 115, 158, 288
DpnII	GATC	4 cut(s)	27, 113, 156, 286
DrdI	GACNNNNNNGTC	1 cut(s)	425
DseDI	GACNNNNNNGTC	1 cut(s)	425
EaeI	YGGCCR	2 cut(s)	3, 403
Eco130I	CCWWGG	1 cut(s)	337
Eco57I	CTGAAG	1 cut(s)	156
EcoRI	GAATTC	1 cut(s)	203
EcoRII	CCWGG	1 cut(s)	405
EcoT14I	CCWWGG	1 cut(s)	337
ErhI	CCWWGG	1 cut(s)	337
FaeI	CATG	2 cut(s)	157, 326
FaiI	YATR	4 cut(s)	155, 300, 324, 417
FalI	AAGNNNNNCTT	2 cut(s)	32, 64
FaqI	GGGAC	2 cut(s)	115, 135
FatI	CATG	2 cut(s)	153, 322
FbaI	TGATCA	1 cut(s)	156
Fnu4HI	GCNGC	3 cut(s)	11, 79, 309
FokI	GGATG	2 cut(s)	380, 445
Fsp4HI	GCNGC	3 cut(s)	11, 79, 309
GluI	GCNGC	3 cut(s)	11, 79, 309
HaeIII	GGCC	2 cut(s)	5, 405
Hin1II	CATG	2 cut(s)	157, 326
HindIII	AAGCTT	1 cut(s)	264
HinfI	GANTC	2 cut(s)	242, 376
HphI	GGTGA	3 cut(s)	76, 410, 421
Hpy166II	GTNNAC	1 cut(s)	412
Hpy188I	TCNGA	3 cut(s)	202, 247, 291
Hpy188III	TCNNGA	3 cut(s)	208, 380, 430
Hpy8I	GTNNAC	1 cut(s)	412
HpyAV	CCTTC	1 cut(s)	226
HpyCH4III	ACNGT	1 cut(s)	106
HpyCH4V	TGCA	3 cut(s)	81, 148, 311
HpyF10VI	GCNNNNNNNGC	1 cut(s)	78
HpyF3I	CTNAG	1 cut(s)	246
Hsp92II	CATG	2 cut(s)	157, 326
Ksp22I	TGATCA	1 cut(s)	156
Kzo9I	GATC	4 cut(s)	27, 113, 156, 286
LmnI	GCTCC	1 cut(s)	22
LpnPI	CCDG	5 cut(s)	104, 191, 392, 415, 419
Lsp1109I	GCAGC	3 cut(s)	22, 65, 295
LweI	GCATC	3 cut(s)	90, 160, 426
MalI	GATC	4 cut(s)	29, 115, 158, 288
MboI	GATC	4 cut(s)	27, 113, 156, 286
MboII	GAAGA	3 cut(s)	238, 371, 404
MfeI	CAATTG	1 cut(s)	189
MflI	RGATCY	1 cut(s)	113
MlsI	TGGCCA	1 cut(s)	405
MluCI	AATT	5 cut(s)	95, 143, 189, 203, 211
MluNI	TGGCCA	1 cut(s)	405
MnlI	CCTC	5 cut(s)	13, 65, 157, 241, 244
Mox20I	TGGCCA	1 cut(s)	405
MscI	TGGCCA	1 cut(s)	405
MseI	TTAA	1 cut(s)	441
Msp20I	TGGCCA	1 cut(s)	405
MspR9I	CCNGG	1 cut(s)	407
MunI	CAATTG	1 cut(s)	189
MvaI	CCWGG	1 cut(s)	407
MvnI	CGCG	1 cut(s)	381
MwoI	GCNNNNNNNGC	1 cut(s)	78
NdeII	GATC	4 cut(s)	27, 113, 156, 286
NlaIII	CATG	2 cut(s)	157, 326
NmeAIII	GCCGAG	2 cut(s)	31, 58
NruI	TCGCGA	1 cut(s)	381
NspI	RCATGY	1 cut(s)	326
PciI	ACATGT	1 cut(s)	322
PfeI	GAWTC	2 cut(s)	242, 376
PkrI	GCNGC	3 cut(s)	12, 80, 310
PscI	ACATGT	1 cut(s)	322
Psp6I	CCWGG	1 cut(s)	405
PspGI	CCWGG	1 cut(s)	405
PstI	CTGCAG	1 cut(s)	313
PsuI	RGATCY	1 cut(s)	113
RruI	TCGCGA	1 cut(s)	381
SaqAI	TTAA	1 cut(s)	441
SatI	GCNGC	3 cut(s)	11, 79, 309
Sau3AI	GATC	4 cut(s)	27, 113, 156, 286
ScrFI	CCNGG	1 cut(s)	407
SetI	ASST	8 cut(s)	15, 142, 168, 268, 276, 318, 339, 411
SfaNI	GCATC	3 cut(s)	90, 160, 426
SfcI	CTRYAG	1 cut(s)	309
Sse9I	AATT	5 cut(s)	95, 143, 189, 203, 211
StyD4I	CCNGG	1 cut(s)	405
StyI	CCWWGG	1 cut(s)	337
TaaI	ACNGT	1 cut(s)	106
TaqI	TCGA	1 cut(s)	319
TaqII	GACCGA	1 cut(s)	368
TasI	AATT	5 cut(s)	95, 143, 189, 203, 211
TfiI	GAWTC	2 cut(s)	242, 376
Tru1I	TTAA	1 cut(s)	441
Tru9I	TTAA	1 cut(s)	441
TscAI	CASTG	1 cut(s)	139
TseI	GCWGC	3 cut(s)	10, 78, 308
TspDTI	ATGAA	3 cut(s)	245, 372, 405
TspGWI	ACGGA	1 cut(s)	32
TspRI	CASTG	1 cut(s)	139
XapI	RAATTY	2 cut(s)	203, 211
XceI	RCATGY	1 cut(s)	326
XcmI	CCANNNNNNNNNTGG	1 cut(s)	94

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.