Rmu_sc0006328.1_g000002

Monocopper oxidase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006328.1
OG0018243
Physical Location & Seq
Reverse (-)
12656 .. 13221
566 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 318 bp
atggtgctggttgaaacagaaggatcctacactgatgaaagcaccatggattctgttgatgtacgtggtggacagtcctactctgtgcttgtcacagctgatcaagccacttcagactattacatggtagcaactcctaaattgcttaatatcactgatatgaccaaatttggaattggtgtgttgaactatgataactccaccacagctgctggtggacctctaccaattggccctgatctgtttgatctagaattctccatcaaaccaagccaagtccttcaggtggaacctgactacagggacagcaaggcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

105

Amino Acids

11.36

Weight (kDa)

4.05

Isoelectric Point (pI)

34.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase PF00394 1 - 66 4.2e-14 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018243)

Species Orthologous Gene IDs
rosa_laevigata RLG00000027642
rosa_multiflora Rmu_sc0005725.1_g000001 Rmu_sc0006328.1_g000002 Rmu_sc0007589.1_g000003
rosa_roxburghii Rroxscaffold_4G00294480
rosa_rugosa Rorug01G0294700
rosa_samantha Rh1BG267300 Rh1CG285400 Rh1DG297400 Rh2AG328600
rosa_wichuraiana Rw1G027070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 18, 31
AcsI RAATTY 2 cut(s) 167, 254
AcuI CTGAAG 2 cut(s) 96, 266
AfaI GTAC 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 286
AgsI TTSAA 2 cut(s) 14, 187
AluBI AGCT 2 cut(s) 98, 209
AluI AGCT 2 cut(s) 98, 209
AlwI GGATC 2 cut(s) 18, 31
AlwNI CAGNNNCTG 1 cut(s) 212
AoxI GGCC 2 cut(s) 232, 312
ApeKI GCWGC 1 cut(s) 209
ApoI RAATTY 2 cut(s) 167, 254
AspS9I GGNCC 2 cut(s) 218, 233
AvaII GGWCC 1 cut(s) 218
BamHI GGATCC 1 cut(s) 23
BbvI GCAGC 1 cut(s) 196
BccI CCATC 1 cut(s) 269
BclI TGATCA 1 cut(s) 100
BfaI CTAG 1 cut(s) 251
BfmI CTRYAG 1 cut(s) 298
BisI GCNGC 1 cut(s) 210
BlsI GCNGC 1 cut(s) 211
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 218, 233
BmiI GGNNCC 2 cut(s) 25, 291
BsaAI YACGTR 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 286
BseDI CCNNGG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 286
BseXI GCAGC 1 cut(s) 196
BshFI GGCC 2 cut(s) 234, 314
BslI CCNNNNNNNGG 1 cut(s) 286
BsnI GGCC 2 cut(s) 234, 314
Bsp143I GATC 4 cut(s) 23, 100, 238, 247
Bsp19I CCATGG 1 cut(s) 45
BspANI GGCC 2 cut(s) 234, 314
BspLI GGNNCC 2 cut(s) 25, 291
BspPI GGATC 2 cut(s) 18, 31
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 4 cut(s) 23, 100, 238, 247
BssT1I CCWWGG 1 cut(s) 45
Bst4CI ACNGT 1 cut(s) 75
BstBAI YACGTR 1 cut(s) 65
BstDSI CCRYGG 1 cut(s) 45
BstKTI GATC 4 cut(s) 26, 103, 241, 250
BstMBI GATC 4 cut(s) 23, 100, 238, 247
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 298
BstV1I GCAGC 1 cut(s) 196
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
BsuRI GGCC 2 cut(s) 234, 314
BtgI CCRYGG 1 cut(s) 45
BtsIMutI CAGTG 2 cut(s) 30, 153
CaiI CAGNNNCTG 1 cut(s) 212
Cfr13I GGNCC 2 cut(s) 218, 233
Csp6I GTAC 1 cut(s) 62
CviAII CATG 2 cut(s) 46, 124
CviJI RGCY 6 cut(s) 98, 107, 209, 234, 273, 314
CviKI_1 RGCY 6 cut(s) 98, 107, 209, 234, 273, 314
CviQI GTAC 1 cut(s) 62
DpnI GATC 4 cut(s) 25, 102, 240, 249
DpnII GATC 4 cut(s) 23, 100, 238, 247
Eco130I CCWWGG 1 cut(s) 45
Eco147I AGGCCT 1 cut(s) 314
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 2 cut(s) 96, 266
EcoRI GAATTC 1 cut(s) 254
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 49, 127
FaiI YATR 4 cut(s) 47, 125, 161, 192
FatI CATG 2 cut(s) 45, 123
FbaI TGATCA 1 cut(s) 100
Fnu4HI GCNGC 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 210
FspBI CTAG 1 cut(s) 251
GluI GCNGC 1 cut(s) 210
HaeIII GGCC 2 cut(s) 234, 314
Hin1II CATG 2 cut(s) 49, 127
HinfI GANTC 1 cut(s) 50
Hpy166II GTNNAC 2 cut(s) 71, 218
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 2 cut(s) 71, 218
HpyAV CCTTC 2 cut(s) 14, 290
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4IV ACGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 2 cut(s) 49, 127
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 4 cut(s) 23, 100, 238, 247
LpnPI CCDG 5 cut(s) 198, 249, 269, 286, 306
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 1 cut(s) 251
MaeII ACGT 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 91
MalI GATC 4 cut(s) 25, 102, 240, 249
MboI GATC 4 cut(s) 23, 100, 238, 247
MfeI CAATTG 1 cut(s) 228
MflI RGATCY 1 cut(s) 23
MluCI AATT 5 cut(s) 140, 167, 174, 228, 254
MnlI CCTC 1 cut(s) 231
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 158
MspA1I CMGCKG 2 cut(s) 98, 209
MunI CAATTG 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 104
NcoI CCATGG 1 cut(s) 45
NdeII GATC 4 cut(s) 23, 100, 238, 247
NlaIII CATG 2 cut(s) 49, 127
NlaIV GGNNCC 2 cut(s) 25, 291
NmuCI GTSAC 1 cut(s) 91
PceI AGGCCT 1 cut(s) 314
PfeI GAWTC 1 cut(s) 50
PkrI GCNGC 1 cut(s) 211
Ppu21I YACGTR 1 cut(s) 65
PspN4I GGNNCC 2 cut(s) 25, 291
PspPI GGNCC 2 cut(s) 218, 233
PstNI CAGNNNCTG 1 cut(s) 212
PsuI RGATCY 1 cut(s) 23
PvuII CAGCTG 2 cut(s) 98, 209
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
RseI CAYNNNNRTG 1 cut(s) 158
SaqAI TTAA 1 cut(s) 147
SatI GCNGC 1 cut(s) 210
Sau3AI GATC 4 cut(s) 23, 100, 238, 247
Sau96I GGNCC 2 cut(s) 218, 233
SetI ASST 6 cut(s) 67, 100, 211, 223, 288, 295
SfcI CTRYAG 1 cut(s) 298
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 158
Sse9I AATT 5 cut(s) 140, 167, 174, 228, 254
SseBI AGGCCT 1 cut(s) 314
SspMI CTAG 1 cut(s) 251
StuI AGGCCT 1 cut(s) 314
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 75
TaiI ACGT 1 cut(s) 67
TasI AATT 5 cut(s) 140, 167, 174, 228, 254
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 2 cut(s) 37, 160
TseFI GTSAC 1 cut(s) 91
TseI GCWGC 1 cut(s) 209
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 51
TspRI CASTG 2 cut(s) 37, 160
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 2 cut(s) 167, 254
XbaI TCTAGA 1 cut(s) 250
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.