Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007157.1

Orthogroup ID

OG0018396

Physical Location & Seq

Genomic Coordinates Reverse (-)

10850 .. 11461

Gene Structure 612 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007157.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 612 bp

atggcggtttgtgtttcacttactgccttcatcagtgtcatcgtactcttgtgttacttcttgattacaccctctaaaccttcgattcatgtaaccgatgcctcgctcacccctcctaacaacaacaccaccacccaccaccactacaatcttgccctaaacatcaccctccggaaccctaactggtccttcaaaacctataacaagaagaccaaactcgttgcttactgcaagaacaaccagaagcgaattggcacggcggagttgtacccctttgggcaacgcacaaggaagacaactacttttacagcattgtcattcaaaggtgaagaaggggaggatgacttgaaggcatgtgaggaaggtgacaatggcgattacgatgacgtagttatcaagctctatcttacgaatatctactatctgatagggccgaatgtaaaggggcgctgttgggaagtggagaccgagttcgtatgtaacttgaaggttcctctgatcactggtgcttatgttaatggttcccaatccaccatggccaataccactggtagtagtccgaaaagttttacggttacaaagtgcaaatcaaatttctctctttatcactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LEA_2

Protein Analysis

203

Amino Acids

22.72

Weight (kDa)

8.76

Isoelectric Point (pI)

31.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018396)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g12441
rosa_chinensis	RchiOBHm_Chr5g0020351
rosa_multiflora	Rmu_sc0002087.1_g000002 Rmu_sc0007157.1_g000004
rosa_rugosa	Rorug05G0058800
rosa_samantha	Rh5AG149000 Rh5BG148700 Rh5CG160200 Rh5DG147400
rosa_wichuraiana	Rw5G013210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	171
AciI	CCGC	2 cut(s)	5, 260
AcoI	YGGCCR	1 cut(s)	537
AcsI	RAATTY	1 cut(s)	592
AfaI	GTAC	2 cut(s)	45, 269
AgsI	TTSAA	4 cut(s)	193, 322, 349, 487
AloI	GAACNNNNNNTCC	2 cut(s)	455, 487
AluBI	AGCT	1 cut(s)	400
AluI	AGCT	1 cut(s)	400
Alw26I	GTCTC	1 cut(s)	458
Aor13HI	TCCGGA	1 cut(s)	171
AoxI	GGCC	2 cut(s)	431, 537
ApoI	RAATTY	1 cut(s)	592
AspLEI	GCGC	1 cut(s)	450
AspS9I	GGNCC	2 cut(s)	186, 431
AsuHPI	GGTGA	4 cut(s)	100, 157, 338, 377
AvaII	GGWCC	1 cut(s)	186
BalI	TGGCCA	1 cut(s)	539
BbsI	GAAGAC	2 cut(s)	215, 299
BceAI	ACGGC	1 cut(s)	273
BclI	TGATCA	1 cut(s)	498
BcoDI	GTCTC	1 cut(s)	458
BfaI	CTAG	1 cut(s)	610
BfoI	RGCGCY	1 cut(s)	451
Bme18I	GGWCC	1 cut(s)	186
BmgT120I	GGNCC	2 cut(s)	186, 431
BmiI	GGNNCC	3 cut(s)	176, 492, 523
BmsI	GCATC	1 cut(s)	88
BpiI	GAAGAC	2 cut(s)	215, 299
BsaI	GGTCTC	1 cut(s)	458
BsaJI	CCNNGG	1 cut(s)	534
BsaWI	WCCGGW	1 cut(s)	171
BsaXI	ACNNNNNCTCC	2 cut(s)	455, 485
Bse1I	ACTGG	3 cut(s)	188, 508, 553
BseAI	TCCGGA	1 cut(s)	171
BseDI	CCNNGG	1 cut(s)	534
BseGI	GGATG	1 cut(s)	346
BseNI	ACTGG	3 cut(s)	188, 508, 553
BshFI	GGCC	2 cut(s)	433, 539
BsiSI	CCGG	1 cut(s)	172
BsmAI	GTCTC	1 cut(s)	458
BsnI	GGCC	2 cut(s)	433, 539
Bso31I	GGTCTC	1 cut(s)	458
Bsp13I	TCCGGA	1 cut(s)	171
Bsp143I	GATC	1 cut(s)	498
Bsp19I	CCATGG	1 cut(s)	534
BspACI	CCGC	2 cut(s)	5, 260
BspANI	GGCC	2 cut(s)	433, 539
BspEI	TCCGGA	1 cut(s)	171
BspLI	GGNNCC	3 cut(s)	176, 492, 523
BspTNI	GGTCTC	1 cut(s)	458
BsrI	ACTGG	3 cut(s)	188, 508, 553
BssECI	CCNNGG	1 cut(s)	534
BssMI	GATC	1 cut(s)	498
BssT1I	CCWWGG	1 cut(s)	534
Bst4CI	ACNGT	1 cut(s)	574
BstDSI	CCRYGG	1 cut(s)	534
BstF5I	GGATG	1 cut(s)	346
BstH2I	RGCGCY	1 cut(s)	451
BstHHI	GCGC	1 cut(s)	450
BstKTI	GATC	1 cut(s)	501
BstMAI	GTCTC	1 cut(s)	458
BstMBI	GATC	1 cut(s)	498
BstNSI	RCATGY	1 cut(s)	357
BstV2I	GAAGAC	2 cut(s)	215, 299
BsuRI	GGCC	2 cut(s)	433, 539
BtgI	CCRYGG	1 cut(s)	534
BtsCI	GGATG	1 cut(s)	346
BtsIMutI	CAGTG	3 cut(s)	40, 501, 546
CfoI	GCGC	1 cut(s)	450
Cfr13I	GGNCC	2 cut(s)	186, 431
Csp6I	GTAC	2 cut(s)	44, 268
CviAII	CATG	3 cut(s)	89, 354, 535
CviJI	RGCY	3 cut(s)	400, 433, 539
CviKI_1	RGCY	3 cut(s)	400, 433, 539
CviQI	GTAC	2 cut(s)	44, 268
DpnI	GATC	1 cut(s)	500
DpnII	GATC	1 cut(s)	498
EaeI	YGGCCR	1 cut(s)	537
EciI	GGCGGA	1 cut(s)	275
Eco130I	CCWWGG	1 cut(s)	534
Eco31I	GGTCTC	1 cut(s)	458
Eco47I	GGWCC	1 cut(s)	186
EcoT14I	CCWWGG	1 cut(s)	534
ErhI	CCWWGG	1 cut(s)	534
FaeI	CATG	3 cut(s)	92, 357, 538
FaiI	YATR	6 cut(s)	90, 201, 355, 478, 513, 536
FatI	CATG	3 cut(s)	88, 353, 534
FbaI	TGATCA	1 cut(s)	498
FokI	GGATG	1 cut(s)	353
FspBI	CTAG	1 cut(s)	610
GlaI	GCGC	1 cut(s)	449
HaeII	RGCGCY	1 cut(s)	451
HaeIII	GGCC	2 cut(s)	433, 539
HapII	CCGG	1 cut(s)	172
HhaI	GCGC	1 cut(s)	450
Hin1II	CATG	3 cut(s)	92, 357, 538
Hin6I	GCGC	1 cut(s)	448
HinP1I	GCGC	1 cut(s)	448
HinfI	GANTC	1 cut(s)	85
HpaII	CCGG	1 cut(s)	172
HphI	GGTGA	4 cut(s)	100, 157, 338, 377
Hpy188I	TCNGA	3 cut(s)	426, 498, 561
Hpy188III	TCNNGA	2 cut(s)	61, 172
HpyAV	CCTTC	7 cut(s)	37, 90, 199, 326, 343, 356, 481
HpyCH4III	ACNGT	1 cut(s)	574
HpyCH4IV	ACGT	1 cut(s)	387
HpyCH4V	TGCA	2 cut(s)	231, 585
HpySE526I	ACGT	1 cut(s)	387
Hsp92II	CATG	3 cut(s)	92, 357, 538
HspAI	GCGC	1 cut(s)	448
Kpn2I	TCCGGA	1 cut(s)	171
Ksp22I	TGATCA	1 cut(s)	498
Kzo9I	GATC	1 cut(s)	498
LpnPI	CCDG	5 cut(s)	169, 185, 254, 489, 534
LweI	GCATC	1 cut(s)	88
MaeI	CTAG	1 cut(s)	610
MaeII	ACGT	1 cut(s)	387
MaeIII	GTNAC	5 cut(s)	53, 91, 365, 479, 574
MalI	GATC	1 cut(s)	500
MboI	GATC	1 cut(s)	498
MboII	GAAGA	3 cut(s)	220, 304, 341
MlsI	TGGCCA	1 cut(s)	539
MluCI	AATT	2 cut(s)	249, 592
MluNI	TGGCCA	1 cut(s)	539
MnlI	CCTC	7 cut(s)	82, 112, 123, 179, 331, 352, 504
Mox20I	TGGCCA	1 cut(s)	539
MroI	TCCGGA	1 cut(s)	171
MscI	TGGCCA	1 cut(s)	539
MseI	TTAA	1 cut(s)	516
Msp20I	TGGCCA	1 cut(s)	539
MspI	CCGG	1 cut(s)	172
NcoI	CCATGG	1 cut(s)	534
NdeII	GATC	1 cut(s)	498
NlaIII	CATG	3 cut(s)	92, 357, 538
NlaIV	GGNNCC	3 cut(s)	176, 492, 523
NmuCI	GTSAC	1 cut(s)	365
NspI	RCATGY	1 cut(s)	357
PfeI	GAWTC	1 cut(s)	85
PspN4I	GGNNCC	3 cut(s)	176, 492, 523
PspPI	GGNCC	2 cut(s)	186, 431
RsaI	GTAC	2 cut(s)	45, 269
RsaNI	GTAC	2 cut(s)	44, 268
SaqAI	TTAA	1 cut(s)	516
Sau3AI	GATC	1 cut(s)	498
Sau96I	GGNCC	2 cut(s)	186, 431
SetI	ASST	7 cut(s)	82, 200, 328, 367, 390, 402, 492
SfaNI	GCATC	1 cut(s)	88
SinI	GGWCC	1 cut(s)	186
Sse9I	AATT	2 cut(s)	249, 592
SsiI	CCGC	2 cut(s)	5, 260
SspMI	CTAG	1 cut(s)	610
StyI	CCWWGG	1 cut(s)	534
TaaI	ACNGT	1 cut(s)	574
TaiI	ACGT	1 cut(s)	390
TaqI	TCGA	1 cut(s)	83
TaqII	GACCGA	1 cut(s)	482
TasI	AATT	2 cut(s)	249, 592
TfiI	GAWTC	1 cut(s)	85
Tru1I	TTAA	1 cut(s)	516
Tru9I	TTAA	1 cut(s)	516
TscAI	CASTG	3 cut(s)	40, 508, 553
TseFI	GTSAC	1 cut(s)	365
Tsp45I	GTSAC	1 cut(s)	365
TspDTI	ATGAA	2 cut(s)	19, 77
TspRI	CASTG	3 cut(s)	40, 508, 553
VpaK11BI	GGWCC	1 cut(s)	186
XapI	RAATTY	1 cut(s)	592
XceI	RCATGY	1 cut(s)	357
XcmI	CCANNNNNNNNNTGG	1 cut(s)	248
XspI	CTAG	1 cut(s)	610

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.