Rmu_sc0007314.1_g000002

Catalyzes the second two steps of the methylation pathway of phosphatidylcholine biosynthesis, the SAM-dependent methylation of phosphatidylmonomethylethanolamine (PMME) to phosphatidyldimethylethanolamine (PDME) and of PDME to phosphatidylcholine (PC)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007314.1
Physical Location & Seq
Forward (+)
1179 .. 4734
3556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007314.1_g000002.1.cds

Sequence Viewer

Length: 495 bp
atggggatagcagcagcaataggagtgctttcacctttcccattttactattggctatggacttccccgcaaacatgggttgccctctgtgggaacgggcgtgacccatgcaaggttatggcctatgtagctcatttcctgaagctgattcagttcctctctctcgtttcagtctcaaccatctcttggcctcctcctctttacttctggcccctcatttcctttggccagtttctcaacttcagggtttatcagttgttaggtgaagctggtacttactatggagttcgtttcggaaagaacattccctgggtgacagaatttccatttgggtatataaaagatcctcaatatgttggaagcatcttaagtctttttgcatgtctgtcatgggtaccctttccatacattttcttgtggacgttgggatatgtttttatgatacatgttgaatccaaggaagatcctgccactcgtgcaaagccgctatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

18.79

Weight (kDa)

8.76

Isoelectric Point (pI)

32.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014527)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G80860 AT1G80860
fragaria_vesca FvH4_6g28630
malus_domestica MD17G1223400.v1.1 MD17G1223600.v1.1
prunus_persica Prupe.3G098300_v2.0.a1
pyrus_communis pycom17g22740
rosa_chinensis RchiOBHm_Chr2g0132951
rosa_laevigata RLG00000019296
rosa_multiflora Rmu_sc0007314.1_g000002
rosa_roxburghii Rroxscaffold_2G00111590
rosa_rugosa Rorug02G0308700
rosa_samantha Rh2AG361200 Rh2BG367000 Rh2CG344400 Rh2DG384000
rosa_wichuraiana Rw2G029370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 394
AccB1I GGYRCC 1 cut(s) 394
AccB7I CCANNNNNTGG 1 cut(s) 186
AciI CCGC 2 cut(s) 68, 485
AclWI GGATC 2 cut(s) 338, 458
AcoI YGGCCR 1 cut(s) 226
AcsI RAATTY 1 cut(s) 320
AcuI CTGAAG 2 cut(s) 161, 226
AfaI GTAC 2 cut(s) 274, 396
AfiI CCNNNNNNNGG 3 cut(s) 90, 112, 186
AflII CTTAAG 1 cut(s) 367
AflIII ACRYGT 1 cut(s) 445
AgsI TTSAA 1 cut(s) 452
AjnI CCWGG 1 cut(s) 308
AjuI GAANNNNNNNTTGG 2 cut(s) 312, 344
AluBI AGCT 3 cut(s) 131, 145, 269
AluI AGCT 3 cut(s) 131, 145, 269
Alw26I GTCTC 1 cut(s) 178
AlwI GGATC 2 cut(s) 338, 458
AoxI GGCC 4 cut(s) 120, 188, 209, 226
ApeKI GCWGC 2 cut(s) 11, 14
ApoI RAATTY 1 cut(s) 320
Asp718I GGTACC 1 cut(s) 394
AspS9I GGNCC 1 cut(s) 210
AsuHPI GGTGA 3 cut(s) 24, 275, 325
BalI TGGCCA 1 cut(s) 228
BanI GGYRCC 1 cut(s) 394
BauI CACGAG 1 cut(s) 474
BbvI GCAGC 2 cut(s) 23, 26
BccI CCATC 1 cut(s) 188
BciT130I CCWGG 1 cut(s) 310
BcoDI GTCTC 1 cut(s) 178
BfrI CTTAAG 1 cut(s) 367
BisI GCNGC 3 cut(s) 12, 15, 485
BlsI GCNGC 3 cut(s) 13, 16, 486
Bme1390I CCNGG 1 cut(s) 310
BmgT120I GGNCC 1 cut(s) 210
BmiI GGNNCC 2 cut(s) 212, 396
BmrFI CCNGG 1 cut(s) 310
BmsI GCATC 1 cut(s) 372
BsaJI CCNNGG 3 cut(s) 308, 309, 456
Bsc4I CCNNNNNNNGG 3 cut(s) 90, 112, 186
Bse1I ACTGG 1 cut(s) 229
BseBI CCWGG 1 cut(s) 310
BseDI CCNNGG 3 cut(s) 308, 309, 456
BseLI CCNNNNNNNGG 3 cut(s) 90, 112, 186
BseNI ACTGG 1 cut(s) 229
BseRI GAGGAG 2 cut(s) 183, 186
BseXI GCAGC 2 cut(s) 23, 26
BshFI GGCC 4 cut(s) 122, 190, 211, 228
BshNI GGYRCC 1 cut(s) 394
BslI CCNNNNNNNGG 3 cut(s) 90, 112, 186
BsmAI GTCTC 1 cut(s) 178
BsnI GGCC 4 cut(s) 122, 190, 211, 228
Bsp143I GATC 2 cut(s) 343, 463
BspACI CCGC 2 cut(s) 68, 485
BspANI GGCC 4 cut(s) 122, 190, 211, 228
BspHI TCATGA 1 cut(s) 491
BspLI GGNNCC 2 cut(s) 212, 396
BspPI GGATC 2 cut(s) 338, 458
BspT107I GGYRCC 1 cut(s) 394
BspTI CTTAAG 1 cut(s) 367
BsrI ACTGG 1 cut(s) 229
BssECI CCNNGG 3 cut(s) 308, 309, 456
BssMI GATC 2 cut(s) 343, 463
BssSI CACGAG 1 cut(s) 474
BssT1I CCWWGG 1 cut(s) 456
Bst2BI CACGAG 1 cut(s) 474
Bst2UI CCWGG 1 cut(s) 310
BstAFI CTTAAG 1 cut(s) 367
BstKTI GATC 2 cut(s) 346, 466
BstMAI GTCTC 1 cut(s) 178
BstMBI GATC 2 cut(s) 343, 463
BstMWI GCNNNNNNNGC 2 cut(s) 128, 476
BstNI CCWGG 1 cut(s) 310
BstNSI RCATGY 2 cut(s) 384, 449
BstSCI CCNGG 1 cut(s) 308
BstV1I GCAGC 2 cut(s) 23, 26
BstX2I RGATCY 2 cut(s) 343, 463
BstYI RGATCY 2 cut(s) 343, 463
BsuRI GGCC 4 cut(s) 122, 190, 211, 228
CciI TCATGA 1 cut(s) 491
Cfr13I GGNCC 1 cut(s) 210
Csp6I GTAC 2 cut(s) 273, 395
CviAII CATG 6 cut(s) 75, 108, 381, 390, 446, 492
CviJI RGCY 9 cut(s) 55, 122, 131, 145, 190, 211, 228, 269, 484
CviKI_1 RGCY 9 cut(s) 55, 122, 131, 145, 190, 211, 228, 269, 484
CviQI GTAC 2 cut(s) 273, 395
DpnI GATC 2 cut(s) 345, 465
DpnII GATC 2 cut(s) 343, 463
EaeI YGGCCR 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 456
Eco57I CTGAAG 2 cut(s) 161, 226
EcoRII CCWGG 1 cut(s) 308
EcoT14I CCWWGG 1 cut(s) 456
ErhI CCWWGG 1 cut(s) 456
FaeI CATG 6 cut(s) 78, 111, 384, 393, 449, 495
FatI CATG 6 cut(s) 74, 107, 380, 389, 445, 491
FauI CCCGC 1 cut(s) 75
Fnu4HI GCNGC 3 cut(s) 12, 15, 485
Fsp4HI GCNGC 3 cut(s) 12, 15, 485
GluI GCNGC 3 cut(s) 12, 15, 485
HaeIII GGCC 4 cut(s) 122, 190, 211, 228
Hin1II CATG 6 cut(s) 78, 111, 384, 393, 449, 495
HinfI GANTC 2 cut(s) 148, 452
HphI GGTGA 3 cut(s) 24, 275, 325
Hpy166II GTNNAC 1 cut(s) 420
Hpy188I TCNGA 1 cut(s) 296
Hpy188III TCNNGA 2 cut(s) 139, 492
Hpy8I GTNNAC 1 cut(s) 420
HpyCH4IV ACGT 1 cut(s) 422
HpyCH4V TGCA 3 cut(s) 111, 380, 479
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 476
HpySE526I ACGT 1 cut(s) 422
Hsp92II CATG 6 cut(s) 78, 111, 384, 393, 449, 495
KpnI GGTACC 1 cut(s) 398
Kzo9I GATC 2 cut(s) 343, 463
LpnPI CCDG 8 cut(s) 152, 193, 229, 242, 255, 295, 322, 480
Lsp1109I GCAGC 2 cut(s) 23, 26
LweI GCATC 1 cut(s) 372
MaeII ACGT 1 cut(s) 422
MaeIII GTNAC 2 cut(s) 101, 313
MalI GATC 2 cut(s) 345, 465
MboI GATC 2 cut(s) 343, 463
MboII GAAGA 1 cut(s) 473
MflI RGATCY 2 cut(s) 343, 463
MlsI TGGCCA 1 cut(s) 228
MluCI AATT 1 cut(s) 320
MluNI TGGCCA 1 cut(s) 228
MmeI TCCRAC 1 cut(s) 337
MnlI CCTC 7 cut(s) 95, 167, 201, 204, 207, 224, 357
Mox20I TGGCCA 1 cut(s) 228
MscI TGGCCA 1 cut(s) 228
MseI TTAA 1 cut(s) 368
Msp20I TGGCCA 1 cut(s) 228
MspCI CTTAAG 1 cut(s) 367
MspR9I CCNGG 1 cut(s) 310
MvaI CCWGG 1 cut(s) 310
MwoI GCNNNNNNNGC 2 cut(s) 128, 476
NdeII GATC 2 cut(s) 343, 463
NlaIII CATG 6 cut(s) 78, 111, 384, 393, 449, 495
NlaIV GGNNCC 2 cut(s) 212, 396
NmuCI GTSAC 2 cut(s) 101, 313
NspI RCATGY 2 cut(s) 384, 449
PagI TCATGA 1 cut(s) 491
PasI CCCWGGG 1 cut(s) 309
PciI ACATGT 1 cut(s) 445
PfeI GAWTC 2 cut(s) 148, 452
PflMI CCANNNNNTGG 1 cut(s) 186
PkrI GCNGC 3 cut(s) 13, 16, 486
PscI ACATGT 1 cut(s) 445
Psp6I CCWGG 1 cut(s) 308
PspGI CCWGG 1 cut(s) 308
PspN4I GGNNCC 2 cut(s) 212, 396
PspPI GGNCC 1 cut(s) 210
PsuI RGATCY 2 cut(s) 343, 463
RsaI GTAC 2 cut(s) 274, 396
RsaNI GTAC 2 cut(s) 273, 395
SaqAI TTAA 1 cut(s) 368
SatI GCNGC 3 cut(s) 12, 15, 485
Sau3AI GATC 2 cut(s) 343, 463
Sau96I GGNCC 1 cut(s) 210
ScrFI CCNGG 1 cut(s) 310
SetI ASST 7 cut(s) 37, 117, 133, 147, 265, 271, 425
SfaNI GCATC 1 cut(s) 372
SmlI CTYRAG 1 cut(s) 367
SmoI CTYRAG 1 cut(s) 367
Sse9I AATT 1 cut(s) 320
SsiI CCGC 2 cut(s) 68, 485
StyD4I CCNGG 1 cut(s) 308
StyI CCWWGG 1 cut(s) 456
TaiI ACGT 1 cut(s) 425
TasI AATT 1 cut(s) 320
TauI GCSGC 1 cut(s) 487
TfiI GAWTC 2 cut(s) 148, 452
Tru1I TTAA 1 cut(s) 368
Tru9I TTAA 1 cut(s) 368
TseFI GTSAC 2 cut(s) 101, 313
TseI GCWGC 2 cut(s) 11, 14
Tsp45I GTSAC 2 cut(s) 101, 313
Van91I CCANNNNNTGG 1 cut(s) 186
Vha464I CTTAAG 1 cut(s) 367
XapI RAATTY 1 cut(s) 320
XceI RCATGY 2 cut(s) 384, 449
XcmI CCANNNNNNNNNTGG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.