Rmu_sc0009140.1_g000012

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009140.1
OG0020601
Physical Location & Seq
Reverse (-)
49122 .. 49493
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009140.1_g000012.1.cds

Sequence Viewer

Length: 372 bp
atgaaggttttcgaagatgtgaccaaacactgtgacgatgagaagttgagaattcaatttgacatggtttggggggtacgactccttagtaatcaaattgcaattcgagtgttcagttttgcggtagattctcgctttcttgatgaagcgagagagctctttaagcctttctctgatcaggccatactgtttgaactggcggtcttcaccatggtcactatggcctactccggggctggcaagaccaaggatgctcacaaggtctacaggcacatgttaggtactgctgttacccctacttcctacgcttacactgcattatcaccgcttgtgatggggttgtccccagctcctatacttactcaattttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

123

Amino Acids

13.9

Weight (kDa)

6.82

Isoelectric Point (pI)

24.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020601)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0230641
rosa_laevigata RLG00000001021
rosa_multiflora Rmu_co8057968.1_g000001 Rmu_sc0002222.1_g000013 Rmu_sc0004952.1_g000009 Rmu_sc0009140.1_g000012

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 264
AciI CCGC 3 cut(s) 122, 200, 326
AcsI RAATTY 1 cut(s) 51
AfaI GTAC 2 cut(s) 78, 283
AfiI CCNNNNNNNGG 1 cut(s) 231
AflIII ACRYGT 1 cut(s) 273
AgsI TTSAA 2 cut(s) 56, 194
AluBI AGCT 2 cut(s) 157, 350
AluI AGCT 2 cut(s) 157, 350
Alw21I GWGCWC 1 cut(s) 159
AoxI GGCC 2 cut(s) 180, 222
ApoI RAATTY 1 cut(s) 51
Asp700I GAANNNNTTC 1 cut(s) 8
AsuC2I CCSGG 1 cut(s) 232
AsuHPI GGTGA 2 cut(s) 199, 315
AsuII TTCGAA 1 cut(s) 12
BaeI ACNNNNGTAYC 2 cut(s) 273, 306
BanII GRGCYC 1 cut(s) 159
BbsI GAAGAC 1 cut(s) 196
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 1 cut(s) 328
BclI TGATCA 1 cut(s) 175
BcnI CCSGG 1 cut(s) 232
BfmI CTRYAG 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 232
BmrFI CCNGG 1 cut(s) 232
BmsI GCATC 1 cut(s) 241
BpiI GAAGAC 1 cut(s) 196
Bpu14I TTCGAA 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 232
BsaJI CCNNGG 3 cut(s) 210, 231, 246
Bsc4I CCNNNNNNNGG 1 cut(s) 231
Bse1I ACTGG 1 cut(s) 201
BseDI CCNNGG 3 cut(s) 210, 231, 246
BseGI GGATG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 201
BseYI CCCAGC 1 cut(s) 346
BshFI GGCC 2 cut(s) 182, 224
BsiHKAI GWGCWC 1 cut(s) 159
BsiSI CCGG 1 cut(s) 231
BslFI GGGAC 1 cut(s) 328
BslI CCNNNNNNNGG 1 cut(s) 231
BsmFI GGGAC 1 cut(s) 328
BsnI GGCC 2 cut(s) 182, 224
Bsp119I TTCGAA 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 175
Bsp19I CCATGG 1 cut(s) 210
BspACI CCGC 3 cut(s) 122, 200, 326
BspANI GGCC 2 cut(s) 182, 224
BspT104I TTCGAA 1 cut(s) 12
BsrI ACTGG 1 cut(s) 201
BssECI CCNNGG 3 cut(s) 210, 231, 246
BssMI GATC 1 cut(s) 175
BssT1I CCWWGG 2 cut(s) 210, 246
Bst4CI ACNGT 2 cut(s) 32, 189
BstBI TTCGAA 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 238
BstDEI CTNAG 1 cut(s) 86
BstDSI CCRYGG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstMWI GCNNNNNNNGC 2 cut(s) 163, 314
BstNSI RCATGY 1 cut(s) 277
BstSCI CCNGG 1 cut(s) 230
BstSFI CTRYAG 1 cut(s) 265
BstV2I GAAGAC 1 cut(s) 196
BsuRI GGCC 2 cut(s) 182, 224
BtgI CCRYGG 1 cut(s) 210
BtsCI GGATG 1 cut(s) 256
BtsI GCAGTG 1 cut(s) 312
BtsIMutI CAGTG 2 cut(s) 28, 312
Cac8I GCNNGC 1 cut(s) 238
Csp6I GTAC 2 cut(s) 77, 282
CviAII CATG 3 cut(s) 64, 211, 274
CviJI RGCY 6 cut(s) 157, 166, 182, 224, 236, 350
CviKI_1 RGCY 6 cut(s) 157, 166, 182, 224, 236, 350
CviQI GTAC 2 cut(s) 77, 282
DdeI CTNAG 1 cut(s) 86
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
Ecl136II GAGCTC 1 cut(s) 157
Eco130I CCWWGG 2 cut(s) 210, 246
Eco24I GRGCYC 1 cut(s) 159
Eco53kI GAGCTC 1 cut(s) 157
EcoICRI GAGCTC 1 cut(s) 157
EcoRI GAATTC 1 cut(s) 51
EcoT14I CCWWGG 2 cut(s) 210, 246
EcoT38I GRGCYC 1 cut(s) 159
ErhI CCWWGG 2 cut(s) 210, 246
FaeI CATG 3 cut(s) 67, 214, 277
FaiI YATR 6 cut(s) 65, 185, 212, 221, 275, 356
FaqI GGGAC 1 cut(s) 328
FatI CATG 3 cut(s) 63, 210, 273
FbaI TGATCA 1 cut(s) 175
FblI GTMKAC 1 cut(s) 264
FokI GGATG 1 cut(s) 263
FriOI GRGCYC 1 cut(s) 159
GsaI CCCAGC 1 cut(s) 350
HaeIII GGCC 2 cut(s) 182, 224
HapII CCGG 1 cut(s) 231
Hin1II CATG 3 cut(s) 67, 214, 277
HinfI GANTC 2 cut(s) 81, 128
HpaII CCGG 1 cut(s) 231
HphI GGTGA 2 cut(s) 199, 315
Hpy166II GTNNAC 1 cut(s) 265
Hpy188I TCNGA 1 cut(s) 175
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 265
HpyCH4III ACNGT 2 cut(s) 32, 189
HpyCH4V TGCA 2 cut(s) 101, 317
HpyF10VI GCNNNNNNNGC 2 cut(s) 163, 314
HpyF3I CTNAG 1 cut(s) 86
Hsp92II CATG 3 cut(s) 67, 214, 277
Ksp22I TGATCA 1 cut(s) 175
Kzo9I GATC 1 cut(s) 175
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 6 cut(s) 164, 182, 222, 244, 253, 360
LweI GCATC 1 cut(s) 241
MaeIII GTNAC 4 cut(s) 19, 32, 214, 289
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 2 cut(s) 26, 196
MhlI GDGCHC 1 cut(s) 159
MluCI AATT 5 cut(s) 51, 56, 96, 102, 365
MlyI GAGTC 1 cut(s) 75
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 2 cut(s) 162, 370
MspI CCGG 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 232
MwoI GCNNNNNNNGC 2 cut(s) 163, 314
NciI CCSGG 1 cut(s) 232
NcoI CCATGG 1 cut(s) 210
NdeII GATC 1 cut(s) 175
NlaIII CATG 3 cut(s) 67, 214, 277
NmuCI GTSAC 3 cut(s) 19, 32, 214
NspI RCATGY 1 cut(s) 277
NspV TTCGAA 1 cut(s) 12
PciI ACATGT 1 cut(s) 273
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 128
PleI GAGTC 1 cut(s) 75
PpsI GAGTC 1 cut(s) 75
PscI ACATGT 1 cut(s) 273
Psp124BI GAGCTC 1 cut(s) 159
PspFI CCCAGC 1 cut(s) 346
RsaI GTAC 2 cut(s) 78, 283
RsaNI GTAC 2 cut(s) 77, 282
SacI GAGCTC 1 cut(s) 159
SaqAI TTAA 2 cut(s) 162, 370
Sau3AI GATC 1 cut(s) 175
SchI GAGTC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 232
SduI GDGCHC 1 cut(s) 159
SetI ASST 5 cut(s) 9, 159, 264, 283, 352
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 265
SfuI TTCGAA 1 cut(s) 12
Sse9I AATT 5 cut(s) 51, 56, 96, 102, 365
SsiI CCGC 3 cut(s) 122, 200, 326
SstI GAGCTC 1 cut(s) 159
StyD4I CCNGG 1 cut(s) 230
StyI CCWWGG 2 cut(s) 210, 246
TaaI ACNGT 2 cut(s) 32, 189
TaqI TCGA 2 cut(s) 12, 106
TasI AATT 5 cut(s) 51, 56, 96, 102, 365
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 2 cut(s) 162, 370
Tru9I TTAA 2 cut(s) 162, 370
TscAI CASTG 2 cut(s) 35, 319
TseFI GTSAC 3 cut(s) 19, 32, 214
Tsp45I GTSAC 3 cut(s) 19, 32, 214
TspDTI ATGAA 2 cut(s) 17, 159
TspRI CASTG 2 cut(s) 35, 319
XapI RAATTY 1 cut(s) 51
XceI RCATGY 1 cut(s) 277
XcmI CCANNNNNNNNNTGG 1 cut(s) 217
XmiI GTMKAC 1 cut(s) 264
XmnI GAANNNNTTC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.