Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009233.1

Orthogroup ID

OG0019303

Physical Location & Seq

Genomic Coordinates Reverse (-)

1098 .. 1718

Gene Structure 621 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009233.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 621 bp

atgggtagtgttagttgtgaaggtggaggaggttgtggtgagagtgagagtgagagtatgatagacagactagaactgaaacttgtccatcgcattctttccttacttaccataactgagctcaccattttcggatgtgtgtccaaaagatgtagagaactttatctgtcaactcccacattgaattttgaggaattttctgtatcgaatacgaattcatgctttagtcggcttaggttgatcaattccttggataggttctttttcaattacgggtctaatcagatagtggcctttcgtttttgttggggaaatcactatccagatgaggacagtgatgaagaactatgcttctgtgttaatgagcattttcgattgatgacgtggatcaacaatgtagtgaggggtaatgttgaagtgcttcatctggagatctcttcttatgatgaaaatgataggaaagagttggtgcttccgccttgcatttttgcttgtggatcgctgaggtccttagtggttgaaatgttttttaccgttattaaagtgcccaccactcttttctctaatctcagagttttggagttgatgaatgctgaagtagagcagggctttttcaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

206

Amino Acids

23.6

Weight (kDa)

4.91

Isoelectric Point (pI)

34.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019303)

Species	Orthologous Gene IDs
prunus_persica	Prupe.7G106300_v2.0.a1
pyrus_communis	pycom14g02510
rosa_multiflora	Rmu_sc0004386.1_g000022 Rmu_sc0009233.1_g000001 Rmu_sc0010389.1_g000010
rosa_samantha	Rh2BG191800 Rh2CG186500 Rh2DG188400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	476
AclWI	GGATC	2 cut(s)	395, 505
AcsI	RAATTY	3 cut(s)	184, 194, 214
AcuI	CTGAAG	1 cut(s)	615
AfiI	CCNNNNNNNGG	1 cut(s)	255
AgsI	TTSAA	5 cut(s)	184, 268, 416, 521, 616
AjiI	CACGTC	1 cut(s)	384
AluBI	AGCT	1 cut(s)	121
AluI	AGCT	1 cut(s)	121
Alw21I	GWGCWC	1 cut(s)	123
AlwI	GGATC	2 cut(s)	395, 505
AoxI	GGCC	1 cut(s)	291
ApoI	RAATTY	3 cut(s)	184, 194, 214
Asp700I	GAANNNNTTC	1 cut(s)	420
AspS9I	GGNCC	1 cut(s)	507
AsuHPI	GGTGA	2 cut(s)	50, 115
AvaII	GGWCC	1 cut(s)	507
BaeGI	GKGCMC	1 cut(s)	549
BanII	GRGCYC	1 cut(s)	123
Bbv12I	GWGCWC	1 cut(s)	123
BbvCI	CCTCAGC	1 cut(s)	503
BccI	CCATC	1 cut(s)	96
BclI	TGATCA	1 cut(s)	240
BfaI	CTAG	1 cut(s)	71
BglII	AGATCT	1 cut(s)	432
Bme18I	GGWCC	1 cut(s)	507
BmgBI	CACGTC	1 cut(s)	384
BmgT120I	GGNCC	1 cut(s)	507
BpmI	CTGGAG	1 cut(s)	449
Bpu10I	CCTNAGC	2 cut(s)	233, 503
BsaJI	CCNNGG	1 cut(s)	249
Bsc4I	CCNNNNNNNGG	1 cut(s)	255
BseDI	CCNNGG	1 cut(s)	249
BseGI	GGATG	1 cut(s)	140
BseLI	CCNNNNNNNGG	1 cut(s)	255
BseMII	CTCAG	3 cut(s)	108, 494, 583
BseRI	GAGGAG	1 cut(s)	42
BseSI	GKGCMC	1 cut(s)	549
BshFI	GGCC	1 cut(s)	293
BsiHKAI	GWGCWC	1 cut(s)	123
BslI	CCNNNNNNNGG	1 cut(s)	255
BsmI	GAATGC	2 cut(s)	93, 595
BsnI	GGCC	1 cut(s)	293
Bsp1286I	GDGCHC	2 cut(s)	123, 549
Bsp143I	GATC	4 cut(s)	240, 387, 432, 497
BspACI	CCGC	1 cut(s)	476
BspANI	GGCC	1 cut(s)	293
BspCNI	CTCAG	3 cut(s)	109, 495, 582
BspPI	GGATC	2 cut(s)	395, 505
BssECI	CCNNGG	1 cut(s)	249
BssMI	GATC	4 cut(s)	240, 387, 432, 497
BssT1I	CCWWGG	1 cut(s)	249
Bst4CI	ACNGT	2 cut(s)	335, 535
Bst6I	CTCTTC	1 cut(s)	442
BstDEI	CTNAG	5 cut(s)	117, 233, 503, 511, 569
BstENI	CCTNNNNNAGG	1 cut(s)	253
BstF5I	GGATG	1 cut(s)	140
BstKTI	GATC	4 cut(s)	243, 390, 435, 500
BstMBI	GATC	4 cut(s)	240, 387, 432, 497
BstSLI	GKGCMC	1 cut(s)	549
BstX2I	RGATCY	1 cut(s)	432
BstYI	RGATCY	1 cut(s)	432
BsuRI	GGCC	1 cut(s)	293
BtgZI	GCGATG	1 cut(s)	74
BtrI	CACGTC	1 cut(s)	384
BtsCI	GGATG	1 cut(s)	140
BtsIMutI	CAGTG	1 cut(s)	340
Cfr13I	GGNCC	1 cut(s)	507
CviAII	CATG	1 cut(s)	219
CviJI	RGCY	4 cut(s)	121, 232, 293, 609
CviKI_1	RGCY	4 cut(s)	121, 232, 293, 609
DdeI	CTNAG	5 cut(s)	117, 233, 503, 511, 569
DpnI	GATC	4 cut(s)	242, 389, 434, 499
DpnII	GATC	4 cut(s)	240, 387, 432, 497
Eam1104I	CTCTTC	1 cut(s)	442
EarI	CTCTTC	1 cut(s)	442
EciI	GGCGGA	1 cut(s)	465
Ecl136II	GAGCTC	1 cut(s)	121
Eco130I	CCWWGG	1 cut(s)	249
Eco24I	GRGCYC	1 cut(s)	123
Eco47I	GGWCC	1 cut(s)	507
Eco53kI	GAGCTC	1 cut(s)	121
Eco57I	CTGAAG	1 cut(s)	615
EcoICRI	GAGCTC	1 cut(s)	121
EcoNI	CCTNNNNNAGG	1 cut(s)	253
EcoO109I	RGGNCCY	1 cut(s)	507
EcoRI	GAATTC	1 cut(s)	214
EcoT14I	CCWWGG	1 cut(s)	249
EcoT38I	GRGCYC	1 cut(s)	123
ErhI	CCWWGG	1 cut(s)	249
FaeI	CATG	1 cut(s)	222
FaiI	YATR	5 cut(s)	59, 113, 220, 349, 444
FatI	CATG	1 cut(s)	218
FbaI	TGATCA	1 cut(s)	240
FokI	GGATG	1 cut(s)	147
FriOI	GRGCYC	1 cut(s)	123
FspBI	CTAG	1 cut(s)	71
GsuI	CTGGAG	1 cut(s)	449
HaeIII	GGCC	1 cut(s)	293
Hin1II	CATG	1 cut(s)	222
HincII	GTYRAC	1 cut(s)	171
HindII	GTYRAC	1 cut(s)	171
HphI	GGTGA	2 cut(s)	50, 115
Hpy166II	GTNNAC	1 cut(s)	171
Hpy188I	TCNGA	3 cut(s)	134, 285, 572
Hpy188III	TCNNGA	2 cut(s)	323, 428
Hpy8I	GTNNAC	1 cut(s)	171
HpyAV	CCTTC	1 cut(s)	14
HpyCH4III	ACNGT	2 cut(s)	335, 535
HpyCH4IV	ACGT	1 cut(s)	383
HpyCH4V	TGCA	1 cut(s)	483
HpyF3I	CTNAG	5 cut(s)	117, 233, 503, 511, 569
HpySE526I	ACGT	1 cut(s)	383
Hsp92II	CATG	1 cut(s)	222
Ksp22I	TGATCA	1 cut(s)	240
Kzo9I	GATC	4 cut(s)	240, 387, 432, 497
LpnPI	CCDG	3 cut(s)	336, 413, 590
MaeI	CTAG	1 cut(s)	71
MaeII	ACGT	1 cut(s)	383
MalI	GATC	4 cut(s)	242, 389, 434, 499
MboI	GATC	4 cut(s)	240, 387, 432, 497
MboII	GAAGA	2 cut(s)	353, 429
MflI	RGATCY	1 cut(s)	432
MhlI	GDGCHC	2 cut(s)	123, 549
MluCI	AATT	5 cut(s)	184, 194, 214, 244, 268
MnlI	CCTC	6 cut(s)	20, 23, 184, 322, 396, 498
MroXI	GAANNNNTTC	1 cut(s)	420
MseI	TTAA	2 cut(s)	360, 540
Mva1269I	GAATGC	2 cut(s)	93, 595
NdeII	GATC	4 cut(s)	240, 387, 432, 497
NlaIII	CATG	1 cut(s)	222
PctI	GAATGC	2 cut(s)	93, 595
PdmI	GAANNNNTTC	1 cut(s)	420
PpuMI	RGGWCCY	1 cut(s)	507
Psp124BI	GAGCTC	1 cut(s)	123
Psp5II	RGGWCCY	1 cut(s)	507
PspPI	GGNCC	1 cut(s)	507
PspPPI	RGGWCCY	1 cut(s)	507
PsuI	RGATCY	1 cut(s)	432
SacI	GAGCTC	1 cut(s)	123
SaqAI	TTAA	2 cut(s)	360, 540
Sau3AI	GATC	4 cut(s)	240, 387, 432, 497
Sau96I	GGNCC	1 cut(s)	507
SduI	GDGCHC	2 cut(s)	123, 549
SetI	ASST	7 cut(s)	25, 34, 123, 239, 260, 386, 509
SinI	GGWCC	1 cut(s)	507
Sse9I	AATT	5 cut(s)	184, 194, 214, 244, 268
SsiI	CCGC	1 cut(s)	476
SspMI	CTAG	1 cut(s)	71
SstI	GAGCTC	1 cut(s)	123
StyI	CCWWGG	1 cut(s)	249
TaaI	ACNGT	2 cut(s)	335, 535
TaiI	ACGT	1 cut(s)	386
TaqI	TCGA	2 cut(s)	206, 373
TasI	AATT	5 cut(s)	184, 194, 214, 244, 268
Tru1I	TTAA	2 cut(s)	360, 540
Tru9I	TTAA	2 cut(s)	360, 540
TscAI	CASTG	1 cut(s)	340
TspDTI	ATGAA	5 cut(s)	207, 354, 413, 462, 602
TspRI	CASTG	1 cut(s)	340
VpaK11BI	GGWCC	1 cut(s)	507
XagI	CCTNNNNNAGG	1 cut(s)	253
XapI	RAATTY	3 cut(s)	184, 194, 214
XmnI	GAANNNNTTC	1 cut(s)	420
XspI	CTAG	1 cut(s)	71

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.