Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009360.1

Orthogroup ID

OG0019717

Physical Location & Seq

Genomic Coordinates Forward (+)

1733 .. 2179

Gene Structure 447 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009360.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 447 bp

ctgaagacggatgtaggtgtcattcactgttatgaatctctcgatgatgttactgtcaattcccttccaactccattcactagcttcctgaagtcatttgatgatgacttcccttcatacatgaaggaggagaaaccttccttagtaaaaggtcagatatgtgatggggatgagggacttcgtgagtgtggtgttcaaaacacacctgctgctgctgctgatgcaggaggagcatcatcaagccgcagcagacttgacacctcatcattggagcagagggctgaagctttagaagcgctgcttgaactttgtgtaagattgttccaagatggaaaatatcaagagcttgaggttgtgcttaagccttttgtgcctggggatgtttgccttagggaaactgctatttggttgactaggatcattaaggaaaatactactgtcaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

148

Amino Acids

16.29

Weight (kDa)

4.61

Isoelectric Point (pI)

40.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019717)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g03290
rosa_laevigata	RLG00000025653
rosa_multiflora	Rmu_sc0004924.1_g000002 Rmu_sc0009360.1_g000002
rosa_samantha	Rh3BG038600 Rh3CG037100 Rh3DG037800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	214
Acc36I	ACCTGC	1 cut(s)	214
AciI	CCGC	1 cut(s)	244
AclWI	GGATC	1 cut(s)	425
AcuI	CTGAAG	3 cut(s)	23, 110, 303
AfeI	AGCGCT	1 cut(s)	297
AflII	CTTAAG	1 cut(s)	359
AgsI	TTSAA	2 cut(s)	197, 305
AjnI	CCWGG	1 cut(s)	373
AluBI	AGCT	3 cut(s)	84, 287, 346
AluI	AGCT	3 cut(s)	84, 287, 346
AlwI	GGATC	1 cut(s)	425
Aor51HI	AGCGCT	1 cut(s)	297
ApeKI	GCWGC	5 cut(s)	209, 212, 215, 246, 298
AspLEI	GCGC	1 cut(s)	298
AxyI	CCTNAGG	1 cut(s)	389
BbsI	GAAGAC	1 cut(s)	11
BbvI	GCAGC	5 cut(s)	196, 199, 202, 258, 285
BccI	CCATC	2 cut(s)	158, 323
BciT130I	CCWGG	1 cut(s)	375
BfaI	CTAG	2 cut(s)	81, 414
BfoI	RGCGCY	1 cut(s)	299
BfrI	CTTAAG	1 cut(s)	359
BfuAI	ACCTGC	1 cut(s)	214
BisI	GCNGC	6 cut(s)	210, 213, 216, 244, 247, 299
BlsI	GCNGC	6 cut(s)	211, 214, 217, 245, 248, 300
Bme1390I	CCNGG	1 cut(s)	375
BmrFI	CCNGG	1 cut(s)	375
BmsI	GCATC	2 cut(s)	211, 242
BpiI	GAAGAC	1 cut(s)	11
BpuEI	CTTGAG	1 cut(s)	368
BsaJI	CCNNGG	1 cut(s)	374
Bse21I	CCTNAGG	1 cut(s)	389
BseBI	CCWGG	1 cut(s)	375
BseDI	CCNNGG	1 cut(s)	374
BseGI	GGATG	3 cut(s)	16, 175, 385
BseRI	GAGGAG	2 cut(s)	143, 243
BseXI	GCAGC	5 cut(s)	196, 199, 202, 258, 285
BslFI	GGGAC	1 cut(s)	189
BsmFI	GGGAC	1 cut(s)	189
Bsp143I	GATC	1 cut(s)	417
BspACI	CCGC	1 cut(s)	244
BspMI	ACCTGC	1 cut(s)	214
BspPI	GGATC	1 cut(s)	425
BspTI	CTTAAG	1 cut(s)	359
BssECI	CCNNGG	1 cut(s)	374
BssMI	GATC	1 cut(s)	417
Bst2UI	CCWGG	1 cut(s)	375
Bst4CI	ACNGT	3 cut(s)	29, 55, 439
BstAFI	CTTAAG	1 cut(s)	359
BstDEI	CTNAG	2 cut(s)	142, 389
BstF5I	GGATG	3 cut(s)	16, 175, 385
BstH2I	RGCGCY	1 cut(s)	299
BstHHI	GCGC	1 cut(s)	298
BstKTI	GATC	1 cut(s)	420
BstMBI	GATC	1 cut(s)	417
BstMWI	GCNNNNNNNGC	5 cut(s)	215, 221, 230, 293, 370
BstNI	CCWGG	1 cut(s)	375
BstSCI	CCNGG	1 cut(s)	373
BstV1I	GCAGC	5 cut(s)	196, 199, 202, 258, 285
BstV2I	GAAGAC	1 cut(s)	11
Bsu36I	CCTNAGG	1 cut(s)	389
BtsCI	GGATG	3 cut(s)	16, 175, 385
BtsIMutI	CAGTG	1 cut(s)	25
BveI	ACCTGC	1 cut(s)	214
CfoI	GCGC	1 cut(s)	298
CviAII	CATG	1 cut(s)	121
CviJI	RGCY	6 cut(s)	84, 243, 281, 287, 346, 364
CviKI_1	RGCY	6 cut(s)	84, 243, 281, 287, 346, 364
DdeI	CTNAG	2 cut(s)	142, 389
DpnI	GATC	1 cut(s)	419
DpnII	GATC	1 cut(s)	417
Eco47III	AGCGCT	1 cut(s)	297
Eco57I	CTGAAG	3 cut(s)	23, 110, 303
Eco81I	CCTNAGG	1 cut(s)	389
EcoRII	CCWGG	1 cut(s)	373
FaeI	CATG	1 cut(s)	124
FaiI	YATR	4 cut(s)	33, 118, 122, 160
FalI	AAGNNNNNCTT	2 cut(s)	285, 317
FaqI	GGGAC	1 cut(s)	189
FatI	CATG	1 cut(s)	120
Fnu4HI	GCNGC	6 cut(s)	210, 213, 216, 244, 247, 299
FokI	GGATG	3 cut(s)	23, 182, 392
Fsp4HI	GCNGC	6 cut(s)	210, 213, 216, 244, 247, 299
FspBI	CTAG	2 cut(s)	81, 414
GlaI	GCGC	1 cut(s)	297
GluI	GCNGC	6 cut(s)	210, 213, 216, 244, 247, 299
HaeII	RGCGCY	1 cut(s)	299
HhaI	GCGC	1 cut(s)	298
Hin1II	CATG	1 cut(s)	124
Hin6I	GCGC	1 cut(s)	296
HinP1I	GCGC	1 cut(s)	296
HincII	GTYRAC	1 cut(s)	411
HindII	GTYRAC	1 cut(s)	411
HindIII	AAGCTT	1 cut(s)	285
HinfI	GANTC	1 cut(s)	35
Hpy166II	GTNNAC	1 cut(s)	411
Hpy188I	TCNGA	1 cut(s)	156
Hpy188III	TCNNGA	4 cut(s)	41, 88, 182, 341
Hpy8I	GTNNAC	1 cut(s)	411
HpyAV	CCTTC	4 cut(s)	74, 118, 123, 147
HpyCH4III	ACNGT	3 cut(s)	29, 55, 439
HpyCH4V	TGCA	1 cut(s)	224
HpyF10VI	GCNNNNNNNGC	5 cut(s)	215, 221, 230, 293, 370
HpyF3I	CTNAG	2 cut(s)	142, 389
Hsp92II	CATG	1 cut(s)	124
HspAI	GCGC	1 cut(s)	296
Kzo9I	GATC	1 cut(s)	417
LmnI	GCTCC	2 cut(s)	230, 271
LpnPI	CCDG	5 cut(s)	101, 210, 219, 360, 387
Lsp1109I	GCAGC	5 cut(s)	196, 199, 202, 258, 285
LweI	GCATC	2 cut(s)	211, 242
MaeI	CTAG	2 cut(s)	81, 414
MaeIII	GTNAC	1 cut(s)	49
MalI	GATC	1 cut(s)	419
MboI	GATC	1 cut(s)	417
MboII	GAAGA	1 cut(s)	16
MluCI	AATT	1 cut(s)	58
MmeI	TCCRAC	1 cut(s)	92
MnlI	CCTC	6 cut(s)	121, 166, 221, 270, 271, 343
MseI	TTAA	2 cut(s)	360, 423
MslI	CAYNNNNRTG	1 cut(s)	30
MspCI	CTTAAG	1 cut(s)	359
MspR9I	CCNGG	1 cut(s)	375
MvaI	CCWGG	1 cut(s)	375
MwoI	GCNNNNNNNGC	5 cut(s)	215, 221, 230, 293, 370
NdeII	GATC	1 cut(s)	417
NlaIII	CATG	1 cut(s)	124
PaqCI	CACCTGC	1 cut(s)	214
PfeI	GAWTC	1 cut(s)	35
PkrI	GCNGC	6 cut(s)	211, 214, 217, 245, 248, 300
Psp6I	CCWGG	1 cut(s)	373
PspGI	CCWGG	1 cut(s)	373
RseI	CAYNNNNRTG	1 cut(s)	30
SaqAI	TTAA	2 cut(s)	360, 423
SatI	GCNGC	6 cut(s)	210, 213, 216, 244, 247, 299
Sau3AI	GATC	1 cut(s)	417
ScrFI	CCNGG	1 cut(s)	375
SetI	ASST	9 cut(s)	19, 86, 139, 154, 208, 263, 289, 348, 354
SfaNI	GCATC	2 cut(s)	211, 242
SmiMI	CAYNNNNRTG	1 cut(s)	30
SmlI	CTYRAG	2 cut(s)	347, 359
SmoI	CTYRAG	2 cut(s)	347, 359
Sse9I	AATT	1 cut(s)	58
SsiI	CCGC	1 cut(s)	244
SspMI	CTAG	2 cut(s)	81, 414
StyD4I	CCNGG	1 cut(s)	373
TaaI	ACNGT	3 cut(s)	29, 55, 439
TaqI	TCGA	1 cut(s)	42
TasI	AATT	1 cut(s)	58
TauI	GCSGC	1 cut(s)	246
TfiI	GAWTC	1 cut(s)	35
Tru1I	TTAA	2 cut(s)	360, 423
Tru9I	TTAA	2 cut(s)	360, 423
TscAI	CASTG	1 cut(s)	32
TseI	GCWGC	5 cut(s)	209, 212, 215, 246, 298
TspDTI	ATGAA	3 cut(s)	48, 105, 137
TspGWI	ACGGA	1 cut(s)	23
TspRI	CASTG	1 cut(s)	32
Vha464I	CTTAAG	1 cut(s)	359
XspI	CTAG	2 cut(s)	81, 414

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.