Rmu_sc0011540.1_g000001

Double-stranded RNA binding motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011540.1
OG0019904
Physical Location & Seq
Reverse (-)
6189 .. 7263
1075 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011540.1_g000001.1.cds

Sequence Viewer

Length: 564 bp
atgtataagaaccgattgcaagaggaggctcagaaaagacgtttaaattttccctcgtattcatccacccgggaaagaccggatcatgccccacgattcaaagcaaccgtcaacttcgatggaaaaccttttgaaagtcctaacttttactctactcttcgagaggcagagaatgctgcagcagaagtagcattgaacaaaggtaaaaaaggagggcataaggccgcagtactggtgagtagcaaaaaccgtagtgcatacatgtttaagaaccgattgcaagagaaggctcagaaaagtcgtttaaaatttccctcgtattcacacacccggaaaggaccggatcatgccccacgattcaaagcaaccgtcaacttcgatggaaaaacttttgaaagtcctaccttttaccctactcttagagaggcagagaatgctgcagcagaagtagcattgaacacagttgaaaaaagagggcataacctagcattggccgcagtactggctgtcctattcatatttctacatgcatggctgtatcccgagtccccgagagaaccctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
dsrm

Protein Analysis

187

Amino Acids

21.26

Weight (kDa)

9.99

Isoelectric Point (pI)

55.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019904)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0452621
rosa_multiflora Rmu_sc0011540.1_g000001
rosa_roxburghii Rroxscaffold_6G00429660
rosa_rugosa Rorug02G0641800
rosa_samantha Rh3AG044300 Rh3BG046600
rosa_wichuraiana Rw3G003450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 225, 495
AclWI GGATC 2 cut(s) 90, 351
AcoI YGGCCR 1 cut(s) 492
AcsI RAATTY 2 cut(s) 46, 308
AfaI GTAC 2 cut(s) 231, 501
AfiI CCNNNNNNNGG 1 cut(s) 490
AflIII ACRYGT 1 cut(s) 261
AgsI TTSAA 7 cut(s) 100, 134, 196, 361, 395, 457, 467
AlwI GGATC 2 cut(s) 90, 351
Ama87I CYCGRG 3 cut(s) 69, 542, 550
AoxI GGCC 2 cut(s) 222, 492
ApeKI GCWGC 4 cut(s) 176, 179, 437, 440
ApoI RAATTY 2 cut(s) 46, 308
ArsI GACNNNNNNTTYG 4 cut(s) 93, 125, 354, 386
AspS9I GGNCC 1 cut(s) 338
AsuC2I CCSGG 3 cut(s) 70, 71, 331
AsuHPI GGTGA 1 cut(s) 247
AvaI CYCGRG 3 cut(s) 69, 542, 550
AvaII GGWCC 1 cut(s) 338
BbvI GCAGC 4 cut(s) 163, 191, 424, 452
BccI CCATC 2 cut(s) 113, 374
BciVI GTATCC 1 cut(s) 549
BcnI CCSGG 3 cut(s) 70, 71, 331
BfaI CTAG 1 cut(s) 485
BfmI CTRYAG 2 cut(s) 177, 438
BfuI GTATCC 1 cut(s) 549
BisI GCNGC 6 cut(s) 177, 180, 225, 438, 441, 495
BlsI GCNGC 6 cut(s) 178, 181, 226, 439, 442, 496
BmcAI AGTACT 2 cut(s) 231, 501
Bme1390I CCNGG 3 cut(s) 70, 71, 331
Bme18I GGWCC 1 cut(s) 338
BmeT110I CYCGRG 3 cut(s) 69, 542, 550
BmgT120I GGNCC 1 cut(s) 338
BmrFI CCNGG 3 cut(s) 70, 71, 331
BpuMI CCSGG 3 cut(s) 70, 71, 331
BsaJI CCNNGG 1 cut(s) 69
BsaWI WCCGGW 2 cut(s) 79, 340
Bsc4I CCNNNNNNNGG 1 cut(s) 490
Bse1I ACTGG 2 cut(s) 237, 507
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 490
BseMII CTCAG 2 cut(s) 44, 305
BseNI ACTGG 2 cut(s) 237, 507
BseRI GAGGAG 1 cut(s) 38
BseXI GCAGC 4 cut(s) 163, 191, 424, 452
BshFI GGCC 2 cut(s) 224, 494
BsiHKCI CYCGRG 3 cut(s) 69, 542, 550
BsiSI CCGG 4 cut(s) 70, 80, 331, 341
BslFI GGGAC 1 cut(s) 532
BslI CCNNNNNNNGG 1 cut(s) 490
BsmFI GGGAC 1 cut(s) 532
BsmI GAATGC 2 cut(s) 178, 439
BsnI GGCC 2 cut(s) 224, 494
BsoBI CYCGRG 3 cut(s) 69, 542, 550
Bsp143I GATC 2 cut(s) 82, 343
BspACI CCGC 2 cut(s) 225, 495
BspANI GGCC 2 cut(s) 224, 494
BspCNI CTCAG 2 cut(s) 43, 304
BspMAI CTGCAG 2 cut(s) 181, 442
BspPI GGATC 2 cut(s) 90, 351
BsrI ACTGG 2 cut(s) 237, 507
BssECI CCNNGG 1 cut(s) 69
BssMI GATC 2 cut(s) 82, 343
Bst4CI ACNGT 4 cut(s) 109, 251, 370, 463
Bst6I CTCTTC 1 cut(s) 162
BstAPI GCANNNNNTGC 2 cut(s) 173, 434
BstDEI CTNAG 3 cut(s) 30, 291, 419
BstF5I GGATG 1 cut(s) 62
BstKTI GATC 2 cut(s) 85, 346
BstMBI GATC 2 cut(s) 82, 343
BstMWI GCNNNNNNNGC 6 cut(s) 173, 188, 434, 449, 494, 503
BstNSI RCATGY 2 cut(s) 265, 530
BstSCI CCNGG 3 cut(s) 68, 69, 329
BstSFI CTRYAG 2 cut(s) 177, 438
BstV1I GCAGC 4 cut(s) 163, 191, 424, 452
BsuI GTATCC 1 cut(s) 549
BsuRI GGCC 2 cut(s) 224, 494
BtsCI GGATG 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 338
Cfr9I CCCGGG 1 cut(s) 69
Csp6I GTAC 2 cut(s) 230, 500
CviAII CATG 5 cut(s) 86, 262, 347, 527, 531
CviJI RGCY 6 cut(s) 29, 224, 290, 494, 506, 535
CviKI_1 RGCY 6 cut(s) 29, 224, 290, 494, 506, 535
CviQI GTAC 2 cut(s) 230, 500
DdeI CTNAG 3 cut(s) 30, 291, 419
DpnI GATC 2 cut(s) 84, 345
DpnII GATC 2 cut(s) 82, 343
DraI TTTAAA 2 cut(s) 45, 306
EaeI YGGCCR 1 cut(s) 492
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 338
Eco88I CYCGRG 3 cut(s) 69, 542, 550
EcoT22I ATGCAT 1 cut(s) 532
FaeI CATG 5 cut(s) 89, 265, 350, 530, 534
FaqI GGGAC 1 cut(s) 532
FatI CATG 5 cut(s) 85, 261, 346, 526, 530
Fnu4HI GCNGC 6 cut(s) 177, 180, 225, 438, 441, 495
FokI GGATG 1 cut(s) 49
Fsp4HI GCNGC 6 cut(s) 177, 180, 225, 438, 441, 495
FspBI CTAG 1 cut(s) 485
GluI GCNGC 6 cut(s) 177, 180, 225, 438, 441, 495
HaeIII GGCC 2 cut(s) 224, 494
HapII CCGG 4 cut(s) 70, 80, 331, 341
Hin1II CATG 5 cut(s) 89, 265, 350, 530, 534
HincII GTYRAC 2 cut(s) 112, 373
HindII GTYRAC 2 cut(s) 112, 373
HinfI GANTC 3 cut(s) 96, 357, 545
HpaII CCGG 4 cut(s) 70, 80, 331, 341
HphI GGTGA 1 cut(s) 247
Hpy166II GTNNAC 2 cut(s) 112, 373
Hpy188I TCNGA 2 cut(s) 33, 294
Hpy188III TCNNGA 2 cut(s) 161, 542
Hpy8I GTNNAC 2 cut(s) 112, 373
HpyAV CCTTC 1 cut(s) 280
HpyCH4III ACNGT 4 cut(s) 109, 251, 370, 463
HpyCH4IV ACGT 1 cut(s) 40
HpyCH4V TGCA 6 cut(s) 19, 179, 257, 280, 440, 530
HpyF10VI GCNNNNNNNGC 6 cut(s) 173, 188, 434, 449, 494, 503
HpyF3I CTNAG 3 cut(s) 30, 291, 419
HpySE526I ACGT 1 cut(s) 40
Hsp92II CATG 5 cut(s) 89, 265, 350, 530, 534
Kzo9I GATC 2 cut(s) 82, 343
LpnPI CCDG 6 cut(s) 83, 93, 218, 344, 354, 488
Lsp1109I GCAGC 4 cut(s) 163, 191, 424, 452
MaeI CTAG 1 cut(s) 485
MaeII ACGT 1 cut(s) 40
MalI GATC 2 cut(s) 84, 345
MboI GATC 2 cut(s) 82, 343
MboII GAAGA 1 cut(s) 149
MluCI AATT 2 cut(s) 46, 308
MlyI GAGTC 1 cut(s) 554
MnlI CCTC 8 cut(s) 16, 19, 64, 157, 206, 325, 418, 467
Mph1103I ATGCAT 1 cut(s) 532
MseI TTAA 3 cut(s) 44, 267, 305
MspI CCGG 4 cut(s) 70, 80, 331, 341
MspR9I CCNGG 3 cut(s) 70, 71, 331
Mva1269I GAATGC 2 cut(s) 178, 439
MwoI GCNNNNNNNGC 6 cut(s) 173, 188, 434, 449, 494, 503
NciI CCSGG 3 cut(s) 70, 71, 331
NdeII GATC 2 cut(s) 82, 343
NlaIII CATG 5 cut(s) 89, 265, 350, 530, 534
NsiI ATGCAT 1 cut(s) 532
NspI RCATGY 2 cut(s) 265, 530
PciI ACATGT 1 cut(s) 261
PctI GAATGC 2 cut(s) 178, 439
PfeI GAWTC 2 cut(s) 96, 357
PkrI GCNGC 6 cut(s) 178, 181, 226, 439, 442, 496
PleI GAGTC 1 cut(s) 553
PpsI GAGTC 1 cut(s) 553
PscI ACATGT 1 cut(s) 261
PspPI GGNCC 1 cut(s) 338
PstI CTGCAG 2 cut(s) 181, 442
RsaI GTAC 2 cut(s) 231, 501
RsaNI GTAC 2 cut(s) 230, 500
SaqAI TTAA 3 cut(s) 44, 267, 305
SatI GCNGC 6 cut(s) 177, 180, 225, 438, 441, 495
Sau3AI GATC 2 cut(s) 82, 343
Sau96I GGNCC 1 cut(s) 338
ScaI AGTACT 2 cut(s) 231, 501
SchI GAGTC 1 cut(s) 554
ScrFI CCNGG 3 cut(s) 70, 71, 331
SetI ASST 5 cut(s) 43, 130, 205, 407, 486
SfcI CTRYAG 2 cut(s) 177, 438
SinI GGWCC 1 cut(s) 338
SmaI CCCGGG 1 cut(s) 71
Sse9I AATT 2 cut(s) 46, 308
SsiI CCGC 2 cut(s) 225, 495
SspMI CTAG 1 cut(s) 485
StyD4I CCNGG 3 cut(s) 68, 69, 329
TaaI ACNGT 4 cut(s) 109, 251, 370, 463
TaiI ACGT 1 cut(s) 43
TaqI TCGA 3 cut(s) 117, 160, 378
TasI AATT 2 cut(s) 46, 308
TatI WGTACW 2 cut(s) 229, 499
TauI GCSGC 2 cut(s) 227, 497
TfiI GAWTC 2 cut(s) 96, 357
Tru1I TTAA 3 cut(s) 44, 267, 305
Tru9I TTAA 3 cut(s) 44, 267, 305
TseI GCWGC 4 cut(s) 176, 179, 437, 440
TspDTI ATGAA 2 cut(s) 51, 505
TspMI CCCGGG 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 338
XapI RAATTY 2 cut(s) 46, 308
XceI RCATGY 2 cut(s) 265, 530
XmaI CCCGGG 1 cut(s) 69
XspI CTAG 1 cut(s) 485
ZrmI AGTACT 2 cut(s) 231, 501
Zsp2I ATGCAT 1 cut(s) 532
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.