Rmu_sc0012307.1_g000008

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012307.1
Physical Location & Seq
Reverse (-)
25035 .. 25976
942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012307.1_g000008.1.cds

Sequence Viewer

Length: 831 bp
atgtctaataattacttgtgtctgctaggagccatagatagtctctggtttcaccaaaccattcttttcccagaacccatttcattacttggccccgaatccactgaaacagctcaagactccatcgcaaatagttctttcacgtacccatcatccggcttggtctccttagcagttgcagatgaagaagtctcctcaaatttctcaaccatgttagaaccggaaaacccatcaccgggtacaccagattcagcagagattagtactccacaggattatgagaggaaaagaccaacaagattagatattgtggcgaacagattgatgttgattcgctctcagtcatcatccccaatatcaaaggatcagagaagtcctcgaaaaaacagaagctctggcttattaacaaggaagctggagaaatccatgagcatgagaagcttgggggagctagaacttgaagaactaaaggggttaatggacctgggcttcactttcgagaaagagaacttaaacccacgaatgatgagcttagtacctggattgcagagacttggagttggagttcatagtaacaacaaaaggatacagaactctagtgataatgatgacgatgttgaggtagttgcaactaagggtgatgatggtggtgttgatgaggattttgaagttgagaggccatatttatcggaggcgtggcttataaagaggcctgattcgccgctgctgaatctaaggttgccaaccagagtgtcctctgctgctgacatgaagaagcatctgaagtcctgggccagaactgttgcttctgaaattcaacaggaatcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

276

Amino Acids

30.69

Weight (kDa)

4.97

Isoelectric Point (pI)

60.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g15581
prunus_persica Prupe.6G239300_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0469151
rosa_laevigata RLG00000024369
rosa_multiflora Rmu_sc0012307.1_g000008
rosa_roxburghii Rroxscaffold_6G00412150
rosa_rugosa Rorug03G0100100
rosa_samantha Rh3AG149200 Rh3BG172400 Rh3CG163500 Rh3DG203200
rosa_wichuraiana Rw3G014080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 704
AciI CCGC 1 cut(s) 722
AclWI GGATC 1 cut(s) 372
AcsI RAATTY 2 cut(s) 199, 813
AcuI CTGAAG 1 cut(s) 803
AfaI GTAC 4 cut(s) 146, 241, 265, 537
AfiI CCNNNNNNNGG 3 cut(s) 155, 235, 236
AgsI TTSAA 3 cut(s) 461, 668, 818
AjnI CCWGG 3 cut(s) 483, 538, 788
AloI GAACNNNNNNTCC 2 cut(s) 549, 581
AluBI AGCT 6 cut(s) 113, 393, 415, 441, 451, 531
AluI AGCT 6 cut(s) 113, 393, 415, 441, 451, 531
Alw26I GTCTC 4 cut(s) 47, 169, 196, 544
AlwI GGATC 1 cut(s) 372
AoxI GGCC 4 cut(s) 91, 677, 710, 792
ApeKI GCWGC 2 cut(s) 724, 761
ApoI RAATTY 2 cut(s) 199, 813
AspS9I GGNCC 3 cut(s) 92, 481, 792
AsuC2I CCSGG 1 cut(s) 237
AsuHPI GGTGA 3 cut(s) 44, 225, 650
AvaII GGWCC 1 cut(s) 481
BbvI GCAGC 2 cut(s) 711, 748
BccI CCATC 4 cut(s) 131, 157, 238, 638
BciT130I CCWGG 3 cut(s) 485, 540, 790
BciVI GTATCC 1 cut(s) 579
BcnI CCSGG 1 cut(s) 237
BcoDI GTCTC 4 cut(s) 47, 169, 196, 544
BfaI CTAG 3 cut(s) 26, 452, 597
BfuI GTATCC 1 cut(s) 579
BisI GCNGC 3 cut(s) 722, 725, 762
BlsI GCNGC 3 cut(s) 723, 726, 763
BmcAI AGTACT 1 cut(s) 265
Bme1390I CCNGG 4 cut(s) 237, 485, 540, 790
Bme18I GGWCC 1 cut(s) 481
BmgT120I GGNCC 3 cut(s) 92, 481, 792
BmiI GGNNCC 2 cut(s) 31, 94
BmrFI CCNGG 4 cut(s) 237, 485, 540, 790
BmsI GCATC 1 cut(s) 787
BplI GAGNNNNNCTC 2 cut(s) 361, 393
BpmI CTGGAG 1 cut(s) 437
Bpu10I CCTNAGC 1 cut(s) 169
BpuEI CTTGAG 1 cut(s) 99
BpuMI CCSGG 1 cut(s) 237
BsaAI YACGTR 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 169
BsaJI CCNNGG 2 cut(s) 484, 789
BsaWI WCCGGW 1 cut(s) 220
BsaXI ACNNNNNCTCC 2 cut(s) 549, 579
Bsc4I CCNNNNNNNGG 3 cut(s) 155, 235, 236
BseBI CCWGG 3 cut(s) 485, 540, 790
BseDI CCNNGG 2 cut(s) 484, 789
BseGI GGATG 2 cut(s) 152, 347
BseLI CCNNNNNNNGG 3 cut(s) 155, 235, 236
BseMII CTCAG 1 cut(s) 353
BseRI GAGGAG 1 cut(s) 184
BseXI GCAGC 2 cut(s) 711, 748
BshFI GGCC 4 cut(s) 93, 679, 712, 794
BsiSI CCGG 3 cut(s) 156, 221, 236
BslI CCNNNNNNNGG 3 cut(s) 155, 235, 236
BsmAI GTCTC 4 cut(s) 47, 169, 196, 544
BsnI GGCC 4 cut(s) 93, 679, 712, 794
Bso31I GGTCTC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 364
BspACI CCGC 1 cut(s) 722
BspANI GGCC 4 cut(s) 93, 679, 712, 794
BspCNI CTCAG 1 cut(s) 352
BspLI GGNNCC 2 cut(s) 31, 94
BspPI GGATC 1 cut(s) 372
BspTNI GGTCTC 1 cut(s) 169
BssECI CCNNGG 2 cut(s) 484, 789
BssMI GATC 1 cut(s) 364
Bst2UI CCWGG 3 cut(s) 485, 540, 790
Bst4CI ACNGT 1 cut(s) 802
BstBAI YACGTR 1 cut(s) 144
BstDEI CTNAG 5 cut(s) 169, 339, 532, 633, 734
BstF5I GGATG 2 cut(s) 152, 347
BstKTI GATC 1 cut(s) 367
BstMAI GTCTC 4 cut(s) 47, 169, 196, 544
BstMBI GATC 1 cut(s) 364
BstMWI GCNNNNNNNGC 2 cut(s) 438, 718
BstNI CCWGG 3 cut(s) 485, 540, 790
BstSCI CCNGG 4 cut(s) 235, 483, 538, 788
BstV1I GCAGC 2 cut(s) 711, 748
BsuI GTATCC 1 cut(s) 579
BsuRI GGCC 4 cut(s) 93, 679, 712, 794
BtgZI GCGATG 1 cut(s) 109
BtsCI GGATG 2 cut(s) 152, 347
BtsIMutI CAGTG 1 cut(s) 102
Cfr13I GGNCC 3 cut(s) 92, 481, 792
Csp6I GTAC 4 cut(s) 145, 240, 264, 536
CviAII CATG 4 cut(s) 211, 427, 433, 769
CviQI GTAC 4 cut(s) 145, 240, 264, 536
DdeI CTNAG 5 cut(s) 169, 339, 532, 633, 734
DpnI GATC 1 cut(s) 366
DpnII GATC 1 cut(s) 364
Eco147I AGGCCT 1 cut(s) 712
Eco31I GGTCTC 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 481
Eco57I CTGAAG 1 cut(s) 803
EcoRII CCWGG 3 cut(s) 483, 538, 788
FaeI CATG 4 cut(s) 214, 430, 436, 772
FaiI YATR 9 cut(s) 35, 212, 279, 428, 434, 570, 682, 704, 770
FatI CATG 4 cut(s) 210, 426, 432, 768
Fnu4HI GCNGC 3 cut(s) 722, 725, 762
FokI GGATG 2 cut(s) 139, 334
Fsp4HI GCNGC 3 cut(s) 722, 725, 762
FspBI CTAG 3 cut(s) 26, 452, 597
GluI GCNGC 3 cut(s) 722, 725, 762
GsuI CTGGAG 1 cut(s) 437
HaeIII GGCC 4 cut(s) 93, 679, 712, 794
HapII CCGG 3 cut(s) 156, 221, 236
Hin1II CATG 4 cut(s) 214, 430, 436, 772
HindIII AAGCTT 1 cut(s) 439
HinfI GANTC 7 cut(s) 98, 119, 248, 331, 716, 730, 824
HpaII CCGG 3 cut(s) 156, 221, 236
HphI GGTGA 3 cut(s) 44, 225, 650
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 4 cut(s) 369, 691, 783, 811
Hpy188III TCNNGA 2 cut(s) 116, 499
Hpy8I GTNNAC 1 cut(s) 242
HpyCH4III ACNGT 1 cut(s) 802
HpyCH4IV ACGT 1 cut(s) 143
HpyCH4V TGCA 3 cut(s) 179, 547, 629
HpyF10VI GCNNNNNNNGC 2 cut(s) 438, 718
HpyF3I CTNAG 5 cut(s) 169, 339, 532, 633, 734
HpySE526I ACGT 1 cut(s) 143
Hsp92II CATG 4 cut(s) 214, 430, 436, 772
Kzo9I GATC 1 cut(s) 364
LmnI GCTCC 2 cut(s) 29, 448
Lsp1109I GCAGC 2 cut(s) 711, 748
LweI GCATC 1 cut(s) 787
MaeI CTAG 3 cut(s) 26, 452, 597
MaeII ACGT 1 cut(s) 143
MaeIII GTNAC 1 cut(s) 572
MalI GATC 1 cut(s) 366
MboI GATC 1 cut(s) 364
MboII GAAGA 3 cut(s) 197, 473, 784
MluCI AATT 3 cut(s) 10, 199, 813
MlyI GAGTC 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 541
MnlI CCTC 9 cut(s) 205, 276, 387, 613, 652, 669, 685, 702, 766
MseI TTAA 4 cut(s) 404, 476, 512, 829
MslI CAYNNNNRTG 1 cut(s) 431
MspA1I CMGCKG 1 cut(s) 724
MspI CCGG 3 cut(s) 156, 221, 236
MspR9I CCNGG 4 cut(s) 237, 485, 540, 790
MvaI CCWGG 3 cut(s) 485, 540, 790
MwoI GCNNNNNNNGC 2 cut(s) 438, 718
NciI CCSGG 1 cut(s) 237
NdeII GATC 1 cut(s) 364
NlaIII CATG 4 cut(s) 214, 430, 436, 772
NlaIV GGNNCC 2 cut(s) 31, 94
PceI AGGCCT 1 cut(s) 712
PfeI GAWTC 6 cut(s) 98, 248, 331, 716, 730, 824
PkrI GCNGC 3 cut(s) 723, 726, 763
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
Ppu21I YACGTR 1 cut(s) 144
PsiI TTATAA 1 cut(s) 704
Psp6I CCWGG 3 cut(s) 483, 538, 788
PspGI CCWGG 3 cut(s) 483, 538, 788
PspN4I GGNNCC 2 cut(s) 31, 94
PspPI GGNCC 3 cut(s) 92, 481, 792
RsaI GTAC 4 cut(s) 146, 241, 265, 537
RsaNI GTAC 4 cut(s) 145, 240, 264, 536
RseI CAYNNNNRTG 1 cut(s) 431
SaqAI TTAA 4 cut(s) 404, 476, 512, 829
SatI GCNGC 3 cut(s) 722, 725, 762
Sau3AI GATC 1 cut(s) 364
Sau96I GGNCC 3 cut(s) 92, 481, 792
ScaI AGTACT 1 cut(s) 265
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 4 cut(s) 237, 485, 540, 790
SfaNI GCATC 1 cut(s) 787
SinI GGWCC 1 cut(s) 481
SmiMI CAYNNNNRTG 1 cut(s) 431
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
Sse9I AATT 3 cut(s) 10, 199, 813
SseBI AGGCCT 1 cut(s) 712
SsiI CCGC 1 cut(s) 722
SspMI CTAG 3 cut(s) 26, 452, 597
StuI AGGCCT 1 cut(s) 712
StyD4I CCNGG 4 cut(s) 235, 483, 538, 788
TaaI ACNGT 1 cut(s) 802
TaiI ACGT 1 cut(s) 146
TaqI TCGA 2 cut(s) 379, 498
TasI AATT 3 cut(s) 10, 199, 813
TatI WGTACW 1 cut(s) 263
TauI GCSGC 1 cut(s) 724
TfiI GAWTC 6 cut(s) 98, 248, 331, 716, 730, 824
Tru1I TTAA 4 cut(s) 404, 476, 512, 829
Tru9I TTAA 4 cut(s) 404, 476, 512, 829
TscAI CASTG 1 cut(s) 109
TseI GCWGC 2 cut(s) 724, 761
TspDTI ATGAA 4 cut(s) 72, 198, 557, 785
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 481
XapI RAATTY 2 cut(s) 199, 813
XspI CTAG 3 cut(s) 26, 452, 597
ZrmI AGTACT 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.