Rmu_sc0012608.1_g000001

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012608.1
OG0022898
Physical Location & Seq
Forward (+)
1 .. 713
713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012608.1_g000001.1.cds

Sequence Viewer

Length: 400 bp
actccaatttttatctgcatctattgaaggaattgttagaggaataggaaatccatgcaaggactgggggttcttccaagtgatcaaccatggagtgccggtggataagctccgaaagattggggctgctactaggaagttctttgctcagcctttggaggagaagaggaagagttggagggatgaaacaaacgtgataggttgcaatgagagagagaatagccagaatgtcaatgagtactggaaggaggtgtttaatttaatagtggaagagcctaccttagaggagaaggaagagcatgaatggactaccaatggcccaagtatcccccggaaatcagttaactcagtcatcactaagggtagtagactagtagatgaatatatacattccgtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

132

Amino Acids

15.18

Weight (kDa)

5.97

Isoelectric Point (pI)

19.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022898)

Species Orthologous Gene IDs
rosa_laevigata RLG00000014528
rosa_multiflora Rmu_sc0012608.1_g000001 Rmu_ssc0000050.1_g000029
rosa_samantha Rh6AG104800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 368
AfaI GTAC 1 cut(s) 240
AgsI TTSAA 1 cut(s) 27
AhlI ACTAGT 1 cut(s) 371
AloI GAACNNNNNNTCC 2 cut(s) 54, 86
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AoxI GGCC 1 cut(s) 317
ApeKI GCWGC 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 318
AsuC2I CCSGG 1 cut(s) 332
BbvI GCAGC 1 cut(s) 113
BciVI GTATCC 1 cut(s) 336
BclI TGATCA 1 cut(s) 82
BcnI CCSGG 1 cut(s) 332
BcuI ACTAGT 1 cut(s) 371
BfaI CTAG 2 cut(s) 133, 372
BfuI GTATCC 1 cut(s) 336
BisI GCNGC 1 cut(s) 127
BlpI GCTNAGC 1 cut(s) 148
BlsI GCNGC 1 cut(s) 128
BmcAI AGTACT 1 cut(s) 240
Bme1390I CCNGG 1 cut(s) 332
BmgT120I GGNCC 1 cut(s) 318
BmrFI CCNGG 1 cut(s) 332
BmrI ACTGGG 1 cut(s) 74
BmsI GCATC 1 cut(s) 27
BmuI ACTGGG 1 cut(s) 74
Bpu1102I GCTNAGC 1 cut(s) 148
BpuMI CCSGG 1 cut(s) 332
BsaJI CCNNGG 2 cut(s) 89, 330
BsaXI ACNNNNNCTCC 2 cut(s) 85, 115
Bse118I RCCGGY 1 cut(s) 98
Bse1I ACTGG 2 cut(s) 69, 246
Bse3DI GCAATG 1 cut(s) 212
BseDI CCNNGG 2 cut(s) 89, 330
BseGI GGATG 1 cut(s) 188
BseMI GCAATG 1 cut(s) 212
BseMII CTCAG 2 cut(s) 162, 361
BseNI ACTGG 2 cut(s) 69, 246
BseRI GAGGAG 2 cut(s) 174, 300
BseXI GCAGC 1 cut(s) 113
BshFI GGCC 1 cut(s) 319
BsiSI CCGG 2 cut(s) 99, 332
BsnI GGCC 1 cut(s) 319
Bsp143I GATC 1 cut(s) 82
Bsp1720I GCTNAGC 1 cut(s) 148
Bsp19I CCATGG 1 cut(s) 89
BspANI GGCC 1 cut(s) 319
BspCNI CTCAG 2 cut(s) 161, 360
BspQI GCTCTTC 2 cut(s) 265, 289
BsrDI GCAATG 1 cut(s) 212
BsrFI RCCGGY 1 cut(s) 98
BsrI ACTGG 2 cut(s) 69, 246
BssAI RCCGGY 1 cut(s) 98
BssECI CCNNGG 2 cut(s) 89, 330
BssMI GATC 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 89
Bst6I CTCTTC 4 cut(s) 159, 165, 265, 289
BstDEI CTNAG 4 cut(s) 148, 281, 347, 358
BstDSI CCRYGG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 188
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 330
BstV1I GCAGC 1 cut(s) 113
BsuI GTATCC 1 cut(s) 336
BsuRI GGCC 1 cut(s) 319
BtgI CCRYGG 1 cut(s) 89
BtsCI GGATG 1 cut(s) 188
Cfr10I RCCGGY 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 318
Csp6I GTAC 1 cut(s) 239
CviAII CATG 3 cut(s) 55, 90, 300
CviJI RGCY 6 cut(s) 110, 126, 152, 223, 275, 319
CviKI_1 RGCY 6 cut(s) 110, 126, 152, 223, 275, 319
CviQI GTAC 1 cut(s) 239
DdeI CTNAG 4 cut(s) 148, 281, 347, 358
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eam1104I CTCTTC 4 cut(s) 159, 165, 265, 289
EarI CTCTTC 4 cut(s) 159, 165, 265, 289
Eco130I CCWWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 3 cut(s) 58, 93, 303
FaiI YATR 5 cut(s) 56, 91, 301, 385, 387
FatI CATG 3 cut(s) 54, 89, 299
FbaI TGATCA 1 cut(s) 82
FblI GTMKAC 1 cut(s) 368
Fnu4HI GCNGC 1 cut(s) 127
FokI GGATG 1 cut(s) 195
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 2 cut(s) 133, 372
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 319
HapII CCGG 2 cut(s) 99, 332
Hin1II CATG 3 cut(s) 58, 93, 303
HincII GTYRAC 1 cut(s) 344
HindII GTYRAC 1 cut(s) 344
HpaI GTTAAC 1 cut(s) 344
HpaII CCGG 2 cut(s) 99, 332
Hpy166II GTNNAC 2 cut(s) 344, 369
Hpy188I TCNGA 1 cut(s) 114
Hpy8I GTNNAC 2 cut(s) 344, 369
HpyAV CCTTC 3 cut(s) 21, 239, 284
HpyCH4IV ACGT 1 cut(s) 193
HpyCH4V TGCA 3 cut(s) 18, 58, 205
HpyF3I CTNAG 4 cut(s) 148, 281, 347, 358
HpySE526I ACGT 1 cut(s) 193
Hsp92II CATG 3 cut(s) 58, 93, 303
Ksp22I TGATCA 1 cut(s) 82
KspAI GTTAAC 1 cut(s) 344
Kzo9I GATC 1 cut(s) 82
LguI GCTCTTC 2 cut(s) 265, 289
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 5 cut(s) 50, 112, 227, 237, 345
Lsp1109I GCAGC 1 cut(s) 113
LweI GCATC 1 cut(s) 27
MaeI CTAG 2 cut(s) 133, 372
MaeII ACGT 1 cut(s) 193
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 5 cut(s) 65, 176, 182, 282, 306
MluCI AATT 3 cut(s) 6, 31, 257
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 6 cut(s) 33, 152, 160, 172, 242, 278
MseI TTAA 3 cut(s) 256, 261, 343
MspI CCGG 2 cut(s) 99, 332
MspR9I CCNGG 1 cut(s) 332
NciI CCSGG 1 cut(s) 332
NcoI CCATGG 1 cut(s) 89
NdeII GATC 1 cut(s) 82
NlaIII CATG 3 cut(s) 58, 93, 303
PciSI GCTCTTC 2 cut(s) 265, 289
PkrI GCNGC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 318
RsaI GTAC 1 cut(s) 240
RsaNI GTAC 1 cut(s) 239
SapI GCTCTTC 2 cut(s) 265, 289
SaqAI TTAA 3 cut(s) 256, 261, 343
SatI GCNGC 1 cut(s) 127
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 1 cut(s) 318
ScaI AGTACT 1 cut(s) 240
ScrFI CCNGG 1 cut(s) 332
SetI ASST 5 cut(s) 112, 196, 203, 253, 282
SfaNI GCATC 1 cut(s) 27
SpeI ACTAGT 1 cut(s) 371
Sse9I AATT 3 cut(s) 6, 31, 257
SspMI CTAG 2 cut(s) 133, 372
StyD4I CCNGG 1 cut(s) 330
StyI CCWWGG 1 cut(s) 89
TaiI ACGT 1 cut(s) 196
TasI AATT 3 cut(s) 6, 31, 257
TatI WGTACW 1 cut(s) 238
Tru1I TTAA 3 cut(s) 256, 261, 343
Tru9I TTAA 3 cut(s) 256, 261, 343
TseI GCWGC 1 cut(s) 126
TspDTI ATGAA 3 cut(s) 199, 316, 394
TspGWI ACGGA 1 cut(s) 383
XcmI CCANNNNNNNNNTGG 1 cut(s) 61
XmiI GTMKAC 1 cut(s) 368
XspI CTAG 2 cut(s) 133, 372
ZrmI AGTACT 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.