Rmu_sc0019211.1_g000002

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019211.1
Physical Location & Seq
Forward (+)
2530 .. 2913
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019211.1_g000002.1.cds

Sequence Viewer

Length: 384 bp
atgctagtagtgcaaggtcagcttattgtgtggtttgatgatacaaatcctgctaaagaaagcaatgagtttgtggaaaatcttctcaaagatattgacactttgggtatcaagtatgaggaggttacctatactttagattacttctctcagttgatggatatgaccaaggagctgattatccagggtaaagcatatgtcgatgatacacctagagaagagatgcaaaagcaacagatagatgggattgagtcaaagtgtagaaaccagagccaagaggaaaatttgaaactgcagggggagatgacagcaggttcagagaggggtctgcagtgttgtgttagagggaagctagccatgcaggaccctaataaatcgctctga

Protein Analysis

127

Amino Acids

14.57

Weight (kDa)

4.49

Isoelectric Point (pI)

28.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022629)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0323471
rosa_multiflora Rmu_sc0019211.1_g000002
rosa_samantha Rh1CG057800 Rh1DG061600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 302
AcsI RAATTY 1 cut(s) 283
AgsI TTSAA 1 cut(s) 289
AjnI CCWGG 1 cut(s) 183
AluBI AGCT 3 cut(s) 22, 175, 352
AluI AGCT 3 cut(s) 22, 175, 352
ApoI RAATTY 1 cut(s) 283
Asp700I GAANNNNTTC 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 364
AsuNHI GCTAGC 1 cut(s) 352
AvaII GGWCC 1 cut(s) 364
BccI CCATC 2 cut(s) 151, 236
BciT130I CCWGG 1 cut(s) 185
BfaI CTAG 3 cut(s) 5, 213, 353
BfmI CTRYAG 2 cut(s) 293, 329
BfuAI ACCTGC 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 364
BmgT120I GGNCC 1 cut(s) 364
BmiI GGNNCC 1 cut(s) 366
BmrFI CCNGG 1 cut(s) 185
BmsI GCATC 1 cut(s) 213
BmtI GCTAGC 1 cut(s) 356
BsaBI GATNNNNATC 1 cut(s) 45
BsaJI CCNNGG 2 cut(s) 168, 184
Bse3DI GCAATG 1 cut(s) 70
Bse8I GATNNNNATC 1 cut(s) 45
BseBI CCWGG 1 cut(s) 185
BseDI CCNNGG 2 cut(s) 168, 184
BseJI GATNNNNATC 1 cut(s) 45
BseMI GCAATG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 134
BspCNI CTCAG 1 cut(s) 163
BspLI GGNNCC 1 cut(s) 366
BspMAI CTGCAG 2 cut(s) 297, 333
BspMI ACCTGC 1 cut(s) 302
BspOI GCTAGC 1 cut(s) 356
BsrDI GCAATG 1 cut(s) 70
BssECI CCNNGG 2 cut(s) 168, 184
BssT1I CCWWGG 1 cut(s) 168
Bst2UI CCWGG 1 cut(s) 185
Bst6I CTCTTC 1 cut(s) 213
BstC8I GCNNGC 1 cut(s) 354
BstDEI CTNAG 1 cut(s) 150
BstEII GGTNACC 1 cut(s) 124
BstMWI GCNNNNNNNGC 3 cut(s) 10, 19, 358
BstNI CCWGG 1 cut(s) 185
BstPI GGTNACC 1 cut(s) 124
BstSCI CCNGG 1 cut(s) 183
BstSFI CTRYAG 2 cut(s) 293, 329
BtsI GCAGTG 1 cut(s) 338
BtsIMutI CAGTG 1 cut(s) 338
BveI ACCTGC 1 cut(s) 302
Cac8I GCNNGC 1 cut(s) 354
Cfr13I GGNCC 1 cut(s) 364
CviAII CATG 1 cut(s) 358
CviJI RGCY 5 cut(s) 22, 175, 273, 352, 356
CviKI_1 RGCY 5 cut(s) 22, 175, 273, 352, 356
DdeI CTNAG 1 cut(s) 150
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco130I CCWWGG 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 364
Eco91I GGTNACC 1 cut(s) 124
EcoO109I RGGNCCY 1 cut(s) 364
EcoO65I GGTNACC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 183
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 361
FaiI YATR 6 cut(s) 117, 132, 164, 196, 198, 359
FalI AAGNNNNNCTT 1 cut(s) 38
FatI CATG 1 cut(s) 357
FauNDI CATATG 1 cut(s) 196
FspBI CTAG 3 cut(s) 5, 213, 353
Hin1II CATG 1 cut(s) 361
HinfI GANTC 1 cut(s) 251
Hpy188I TCNGA 2 cut(s) 319, 383
HpyCH4V TGCA 5 cut(s) 13, 226, 295, 331, 361
HpyF10VI GCNNNNNNNGC 3 cut(s) 10, 19, 358
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 1 cut(s) 361
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 7 cut(s) 63, 170, 197, 281, 281, 297, 347
LweI GCATC 1 cut(s) 213
MaeI CTAG 3 cut(s) 5, 213, 353
MaeIII GTNAC 1 cut(s) 124
MboII GAAGA 2 cut(s) 74, 230
MluCI AATT 1 cut(s) 283
MlyI GAGTC 1 cut(s) 260
MnlI CCTC 5 cut(s) 112, 115, 271, 315, 338
MroXI GAANNNNTTC 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 185
MvaI CCWGG 1 cut(s) 185
MwoI GCNNNNNNNGC 3 cut(s) 10, 19, 358
NdeI CATATG 1 cut(s) 196
NheI GCTAGC 1 cut(s) 352
NlaIII CATG 1 cut(s) 361
NlaIV GGNNCC 1 cut(s) 366
PdmI GAANNNNTTC 1 cut(s) 81
PleI GAGTC 1 cut(s) 259
PpsI GAGTC 1 cut(s) 259
PpuMI RGGWCCY 1 cut(s) 364
Psp5II RGGWCCY 1 cut(s) 364
Psp6I CCWGG 1 cut(s) 183
PspEI GGTNACC 1 cut(s) 124
PspGI CCWGG 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 366
PspPI GGNCC 1 cut(s) 364
PspPPI RGGWCCY 1 cut(s) 364
PstI CTGCAG 2 cut(s) 297, 333
Sau96I GGNCC 1 cut(s) 364
SchI GAGTC 1 cut(s) 260
ScrFI CCNGG 1 cut(s) 185
SetI ASST 8 cut(s) 19, 24, 126, 131, 177, 214, 316, 354
SfaNI GCATC 1 cut(s) 213
SfcI CTRYAG 2 cut(s) 293, 329
SinI GGWCC 1 cut(s) 364
Sse9I AATT 1 cut(s) 283
SspMI CTAG 3 cut(s) 5, 213, 353
StyD4I CCNGG 1 cut(s) 183
StyI CCWWGG 1 cut(s) 168
TaqI TCGA 1 cut(s) 201
TasI AATT 1 cut(s) 283
TscAI CASTG 1 cut(s) 338
TspRI CASTG 1 cut(s) 338
VpaK11BI GGWCC 1 cut(s) 364
XapI RAATTY 1 cut(s) 283
XmnI GAANNNNTTC 1 cut(s) 81
XspI CTAG 3 cut(s) 5, 213, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.