Rmu_sc0019457.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019457.1
Physical Location & Seq
Reverse (-)
2522 .. 2907
386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019457.1_g000003.1.cds

Sequence Viewer

Length: 219 bp
atgacctgcaagtgctcaggaaagatgtcgtatgtgggttttcattccaacacaaagttctcttatattgaatttcttctggttttcagcaaatcattccagaggtttgctgtgaggacatcaaagcagatggatgagctttcaaatttggctgccaagaagaaggaacaacttgccgagcagatgaaggatatctccaattctctcaaagatcggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.34

Weight (kDa)

9.6

Isoelectric Point (pI)

29.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 14
AcsI RAATTY 2 cut(s) 71, 145
AgsI TTSAA 2 cut(s) 71, 144
AjuI GAANNNNNNNTTGG 2 cut(s) 41, 73
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
Alw21I GWGCWC 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 152
ApoI RAATTY 2 cut(s) 71, 145
Asp700I GAANNNNTTC 1 cut(s) 75
Bbv12I GWGCWC 1 cut(s) 17
BbvI GCAGC 1 cut(s) 139
BccI CCATC 1 cut(s) 124
BfuAI ACCTGC 1 cut(s) 14
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
Bpu10I CCTNAGC 1 cut(s) 16
BseGI GGATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 139
BsiHKAI GWGCWC 1 cut(s) 17
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 211
BspCNI CTCAG 1 cut(s) 29
BspMI ACCTGC 1 cut(s) 14
BssMI GATC 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 16
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 1 cut(s) 214
BstMBI GATC 1 cut(s) 211
BstV1I GCAGC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 139
BveI ACCTGC 1 cut(s) 14
CviJI RGCY 2 cut(s) 139, 152
CviKI_1 RGCY 2 cut(s) 139, 152
DdeI CTNAG 1 cut(s) 16
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco32I GATATC 1 cut(s) 193
EcoRV GATATC 1 cut(s) 193
FaiI YATR 2 cut(s) 33, 66
Fnu4HI GCNGC 1 cut(s) 153
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 153
GluI GCNGC 1 cut(s) 153
Hpy188III TCNNGA 2 cut(s) 18, 100
HpyAV CCTTC 2 cut(s) 157, 181
HpyCH4V TGCA 1 cut(s) 9
HpyF3I CTNAG 1 cut(s) 16
Kzo9I GATC 1 cut(s) 211
LpnPI CCDG 4 cut(s) 3, 19, 65, 113
Lsp1109I GCAGC 1 cut(s) 139
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 2 cut(s) 68, 172
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 3 cut(s) 71, 145, 199
MmeI TCCRAC 1 cut(s) 72
MnlI CCTC 2 cut(s) 96, 108
MroXI GAANNNNTTC 1 cut(s) 75
NdeII GATC 1 cut(s) 211
NmeAIII GCCGAG 1 cut(s) 202
PdmI GAANNNNTTC 1 cut(s) 75
PkrI GCNGC 1 cut(s) 154
SatI GCNGC 1 cut(s) 153
Sau3AI GATC 1 cut(s) 211
SduI GDGCHC 1 cut(s) 17
SetI ASST 3 cut(s) 8, 107, 141
SgeI CNNG 8 cut(s) 18, 22, 30, 92, 112, 169, 185, 190
Sse9I AATT 3 cut(s) 71, 145, 199
TasI AATT 3 cut(s) 71, 145, 199
TseI GCWGC 1 cut(s) 152
TspDTI ATGAA 2 cut(s) 32, 200
XapI RAATTY 2 cut(s) 71, 145
XmnI GAANNNNTTC 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.