Rroxscaffold_6G00417290

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
39044613 .. 39046762
2150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00417290.1

Sequence Viewer

Length: 210 bp
ATGGCCGGTGGTGGAAATTTCGTTCACAGAGTCATGTCATACCTCGTCAATGAGCTTCTGGTCGATAGCCTCGCCAACAGCAAATCATTCCAGAGGTTTGCTGTGAGGACATCAAAGCAGATGGATGAGCTTTCAAATTTGGCTGCCAAGAAGAAGGAACAACTTGCCGAGCAGATGAAGGATATCTCCAATTCTCTCAAAGATCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.78

Weight (kDa)

9.52

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 16, 136
AgsI TTSAA 1 cut(s) 135
AloI GAACNNNNNNTCC 1 cut(s) 38
AluBI AGCT 2 cut(s) 55, 130
AluI AGCT 2 cut(s) 55, 130
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 143
ApoI RAATTY 2 cut(s) 16, 136
BbvI GCAGC 1 cut(s) 130
BccI CCATC 1 cut(s) 115
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
Bse118I RCCGGY 1 cut(s) 5
BseGI GGATG 1 cut(s) 130
BseXI GCAGC 1 cut(s) 130
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 202
BspANI GGCC 1 cut(s) 5
BsrFI RCCGGY 1 cut(s) 5
BssAI RCCGGY 1 cut(s) 5
BssMI GATC 1 cut(s) 202
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BstV1I GCAGC 1 cut(s) 130
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 130
Cfr10I RCCGGY 1 cut(s) 5
CviAII CATG 1 cut(s) 34
CviJI RGCY 5 cut(s) 5, 55, 69, 130, 143
CviKI_1 RGCY 5 cut(s) 5, 55, 69, 130, 143
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
EaeI YGGCCR 1 cut(s) 3
Eco32I GATATC 1 cut(s) 184
EcoRV GATATC 1 cut(s) 184
FaeI CATG 1 cut(s) 37
FaiI YATR 2 cut(s) 35, 40
FatI CATG 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 144
FokI GGATG 1 cut(s) 137
Fsp4HI GCNGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 144
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
Hin1II CATG 1 cut(s) 37
HinfI GANTC 1 cut(s) 30
HpaII CCGG 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 148, 172
Hsp92II CATG 1 cut(s) 37
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 3 cut(s) 19, 44, 104
Lsp1109I GCAGC 1 cut(s) 130
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 1 cut(s) 163
MluCI AATT 3 cut(s) 16, 136, 190
MlyI GAGTC 1 cut(s) 39
MnlI CCTC 4 cut(s) 53, 80, 87, 99
MspI CCGG 1 cut(s) 6
NdeII GATC 1 cut(s) 202
NlaIII CATG 1 cut(s) 37
NmeAIII GCCGAG 1 cut(s) 193
PkrI GCNGC 1 cut(s) 145
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
SatI GCNGC 1 cut(s) 144
Sau3AI GATC 1 cut(s) 202
SchI GAGTC 1 cut(s) 39
SetI ASST 4 cut(s) 45, 57, 98, 132
SgeI CNNG 9 cut(s) 18, 46, 56, 71, 83, 103, 160, 176, 181
Sse9I AATT 3 cut(s) 16, 136, 190
TaqI TCGA 1 cut(s) 63
TasI AATT 3 cut(s) 16, 136, 190
TseI GCWGC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 191
XapI RAATTY 2 cut(s) 16, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.