Rmu_sc0020076.1_g000002

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020076.1
Physical Location & Seq
Reverse (-)
1255 .. 2666
1412 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020076.1_g000002.1.cds

Sequence Viewer

Length: 363 bp
atgatgagcagcttggtggtctcggctcctatctcaccagctctccttactccaagcttgccattgttcttgtctctgatatttttggtcctcacccaccacttcaaaacccaatacttttttcgtttggtactaatgatgctcttgtgcttcctcggggttcagctagggaatctgattcctatttcagaagtacaagatgtagtagctgcatatagaaaggacatggagtggcagacaagtgagctacttcttccacacaagaaaatgtgtgatcttaagaaggtgcaagttgatgttgtagtcattgagtcagataatgtggcaaatacaatagcagaggagtttctaagtctgctataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.55

Weight (kDa)

5.46

Isoelectric Point (pI)

34.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023141)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0020076.1_g000002
rosa_samantha Rh7BG464400 Rh7CG508300 Rh7DG475800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 132, 195
AflII CTTAAG 1 cut(s) 278
AgsI TTSAA 1 cut(s) 106
AjuI GAANNNNNNNTTGG 2 cut(s) 105, 137
AluBI AGCT 6 cut(s) 12, 41, 57, 166, 209, 247
AluI AGCT 6 cut(s) 12, 41, 57, 166, 209, 247
Alw26I GTCTC 2 cut(s) 25, 78
Ama87I CYCGRG 1 cut(s) 155
ApeKI GCWGC 2 cut(s) 9, 209
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 2 cut(s) 27, 85
AvaI CYCGRG 1 cut(s) 155
AvaII GGWCC 1 cut(s) 88
BbvI GCAGC 2 cut(s) 21, 196
BcoDI GTCTC 2 cut(s) 25, 78
BfaI CTAG 1 cut(s) 167
BfrI CTTAAG 1 cut(s) 278
BisI GCNGC 2 cut(s) 10, 210
BlsI GCNGC 2 cut(s) 11, 211
Bme18I GGWCC 1 cut(s) 88
BmeT110I CYCGRG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 27
BmsI GCATC 1 cut(s) 129
BsaI GGTCTC 1 cut(s) 25
BsaJI CCNNGG 1 cut(s) 154
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
BseDI CCNNGG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 356
BseXI GCAGC 2 cut(s) 21, 196
BsiHKCI CYCGRG 1 cut(s) 155
BsmAI GTCTC 2 cut(s) 25, 78
Bso31I GGTCTC 1 cut(s) 25
BsoBI CYCGRG 1 cut(s) 155
Bsp143I GATC 1 cut(s) 274
BspLI GGNNCC 1 cut(s) 27
BspTI CTTAAG 1 cut(s) 278
BspTNI GGTCTC 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 1 cut(s) 274
BstAFI CTTAAG 1 cut(s) 278
BstC8I GCNNGC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 350
BstKTI GATC 1 cut(s) 277
BstMAI GTCTC 2 cut(s) 25, 78
BstMBI GATC 1 cut(s) 274
BstV1I GCAGC 2 cut(s) 21, 196
Cac8I GCNNGC 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 88
Csp6I GTAC 2 cut(s) 131, 194
CviAII CATG 1 cut(s) 226
CviJI RGCY 7 cut(s) 12, 26, 41, 57, 166, 209, 247
CviKI_1 RGCY 7 cut(s) 12, 26, 41, 57, 166, 209, 247
CviQI GTAC 2 cut(s) 131, 194
DdeI CTNAG 1 cut(s) 350
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
Eco31I GGTCTC 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 88
Eco88I CYCGRG 1 cut(s) 155
FaeI CATG 1 cut(s) 229
FaiI YATR 4 cut(s) 214, 216, 227, 361
FatI CATG 1 cut(s) 225
Fnu4HI GCNGC 2 cut(s) 10, 210
Fsp4HI GCNGC 2 cut(s) 10, 210
FspBI CTAG 1 cut(s) 167
GluI GCNGC 2 cut(s) 10, 210
Hin1II CATG 1 cut(s) 229
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 3 cut(s) 172, 178, 311
HphI GGTGA 2 cut(s) 27, 85
Hpy188I TCNGA 4 cut(s) 78, 177, 190, 316
HpyAV CCTTC 1 cut(s) 277
HpyCH4V TGCA 2 cut(s) 212, 289
HpyF3I CTNAG 1 cut(s) 350
Hsp92II CATG 1 cut(s) 229
Kzo9I GATC 1 cut(s) 274
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 51
Lsp1109I GCAGC 2 cut(s) 21, 196
LweI GCATC 1 cut(s) 129
MaeI CTAG 1 cut(s) 167
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 1 cut(s) 245
MlyI GAGTC 1 cut(s) 320
MnlI CCTC 3 cut(s) 101, 164, 334
MseI TTAA 1 cut(s) 279
MspCI CTTAAG 1 cut(s) 278
NdeII GATC 1 cut(s) 274
NlaIII CATG 1 cut(s) 229
NlaIV GGNNCC 1 cut(s) 27
PfeI GAWTC 2 cut(s) 172, 178
PkrI GCNGC 2 cut(s) 11, 211
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
PspN4I GGNNCC 1 cut(s) 27
PspPI GGNCC 1 cut(s) 88
RsaI GTAC 2 cut(s) 132, 195
RsaNI GTAC 2 cut(s) 131, 194
SaqAI TTAA 1 cut(s) 279
SatI GCNGC 2 cut(s) 10, 210
Sau3AI GATC 1 cut(s) 274
Sau96I GGNCC 1 cut(s) 88
SchI GAGTC 1 cut(s) 320
SetI ASST 7 cut(s) 14, 43, 59, 168, 211, 249, 288
SfaNI GCATC 1 cut(s) 129
SinI GGWCC 1 cut(s) 88
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
SspMI CTAG 1 cut(s) 167
TatI WGTACW 1 cut(s) 193
TfiI GAWTC 2 cut(s) 172, 178
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TseI GCWGC 2 cut(s) 9, 209
Vha464I CTTAAG 1 cut(s) 278
VpaK11BI GGWCC 1 cut(s) 88
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.