Rh7CG508300

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
68698824 .. 68699959
1136 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG508300.1

Sequence Viewer

Length: 321 bp
ATGTCCGAGCAAGAACAACTGAAATTCCAATCCCCAAGAAAGCTTATGCTTCTACAACTATGTTGGAGGCAAGTTGCATGGAATCTGATTCCTATTTCAGAAGTACAAGATGTAGTAGCTGCATATAGAAAGGACATGGAGTGGCAGACAAGTAAGCTGCTTCTTCCACACAAGAAAATGTGTGATCTTAAGAAGGAGGAGGAGAATGTCTCACTGGAAGTTTTAGCACCCAGGCATAGATCCCTTGGATTTCTTCCAAGAAAGCAAGTTGCTTGTCATAGAGGAAAAGCGAGCACTCCATGTAGTGAAGGCTTTCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.35

Weight (kDa)

9.21

Isoelectric Point (pI)

66.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023141)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0020076.1_g000002
rosa_samantha Rh7BG464400 Rh7CG508300 Rh7DG475800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 234
AcsI RAATTY 1 cut(s) 23
AfaI GTAC 1 cut(s) 105
AflII CTTAAG 1 cut(s) 188
AjnI CCWGG 1 cut(s) 230
AluBI AGCT 3 cut(s) 43, 119, 157
AluI AGCT 3 cut(s) 43, 119, 157
Alw21I GWGCWC 1 cut(s) 296
Alw26I GTCTC 1 cut(s) 214
AlwI GGATC 1 cut(s) 234
ApeKI GCWGC 2 cut(s) 119, 157
ApoI RAATTY 1 cut(s) 23
Asp700I GAANNNNTTC 1 cut(s) 312
Bbv12I GWGCWC 1 cut(s) 296
BbvI GCAGC 2 cut(s) 106, 144
BciT130I CCWGG 1 cut(s) 232
BcoDI GTCTC 1 cut(s) 214
BfrI CTTAAG 1 cut(s) 188
BisI GCNGC 2 cut(s) 120, 158
BlsI GCNGC 2 cut(s) 121, 159
Bme1390I CCNGG 1 cut(s) 232
BmrFI CCNGG 1 cut(s) 232
BplI GAGNNNNNCTC 2 cut(s) 194, 226
BsaJI CCNNGG 2 cut(s) 230, 244
Bse1I ACTGG 1 cut(s) 219
BseBI CCWGG 1 cut(s) 232
BseDI CCNNGG 2 cut(s) 230, 244
BseNI ACTGG 1 cut(s) 219
BseRI GAGGAG 2 cut(s) 212, 215
BseXI GCAGC 2 cut(s) 106, 144
BsiHKAI GWGCWC 1 cut(s) 296
BsmAI GTCTC 1 cut(s) 214
Bsp1286I GDGCHC 1 cut(s) 296
Bsp143I GATC 2 cut(s) 184, 239
BspPI GGATC 1 cut(s) 234
BspTI CTTAAG 1 cut(s) 188
BsrI ACTGG 1 cut(s) 219
BssECI CCNNGG 2 cut(s) 230, 244
BssMI GATC 2 cut(s) 184, 239
BssT1I CCWWGG 1 cut(s) 244
Bst2UI CCWGG 1 cut(s) 232
BstAFI CTTAAG 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 292
BstKTI GATC 2 cut(s) 187, 242
BstMAI GTCTC 1 cut(s) 214
BstMBI GATC 2 cut(s) 184, 239
BstNI CCWGG 1 cut(s) 232
BstSCI CCNGG 1 cut(s) 230
BstV1I GCAGC 2 cut(s) 106, 144
BstX2I RGATCY 1 cut(s) 239
BstYI RGATCY 1 cut(s) 239
BtsIMutI CAGTG 1 cut(s) 212
Cac8I GCNNGC 1 cut(s) 292
Csp6I GTAC 1 cut(s) 104
CviAII CATG 3 cut(s) 78, 136, 300
CviJI RGCY 4 cut(s) 43, 119, 157, 312
CviKI_1 RGCY 4 cut(s) 43, 119, 157, 312
CviQI GTAC 1 cut(s) 104
DpnI GATC 2 cut(s) 186, 241
DpnII GATC 2 cut(s) 184, 239
Eco130I CCWWGG 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 230
EcoT14I CCWWGG 1 cut(s) 244
ErhI CCWWGG 1 cut(s) 244
FaeI CATG 3 cut(s) 81, 139, 303
FaiI YATR 9 cut(s) 47, 61, 79, 124, 126, 137, 237, 279, 301
FatI CATG 3 cut(s) 77, 135, 299
Fnu4HI GCNGC 2 cut(s) 120, 158
Fsp4HI GCNGC 2 cut(s) 120, 158
GluI GCNGC 2 cut(s) 120, 158
Hin1II CATG 3 cut(s) 81, 139, 303
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 2 cut(s) 82, 88
Hpy188I TCNGA 3 cut(s) 7, 87, 100
HpyAV CCTTC 2 cut(s) 187, 302
HpyCH4V TGCA 2 cut(s) 77, 122
Hsp92II CATG 3 cut(s) 81, 139, 303
Kzo9I GATC 2 cut(s) 184, 239
LpnPI CCDG 3 cut(s) 200, 217, 244
Lsp1109I GCAGC 2 cut(s) 106, 144
MalI GATC 2 cut(s) 186, 241
MboI GATC 2 cut(s) 184, 239
MboII GAAGA 2 cut(s) 155, 245
MflI RGATCY 1 cut(s) 239
MhlI GDGCHC 1 cut(s) 296
MluCI AATT 1 cut(s) 23
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 4 cut(s) 60, 190, 193, 275
MroXI GAANNNNTTC 1 cut(s) 312
MseI TTAA 1 cut(s) 189
MspCI CTTAAG 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 232
MvaI CCWGG 1 cut(s) 232
NdeII GATC 2 cut(s) 184, 239
NlaIII CATG 3 cut(s) 81, 139, 303
PdmI GAANNNNTTC 1 cut(s) 312
PfeI GAWTC 2 cut(s) 82, 88
PkrI GCNGC 2 cut(s) 121, 159
Psp6I CCWGG 1 cut(s) 230
PspGI CCWGG 1 cut(s) 230
PsuI RGATCY 1 cut(s) 239
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 189
SatI GCNGC 2 cut(s) 120, 158
Sau3AI GATC 2 cut(s) 184, 239
ScrFI CCNGG 1 cut(s) 232
SduI GDGCHC 1 cut(s) 296
SetI ASST 3 cut(s) 45, 121, 159
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
Sse9I AATT 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 230
StyI CCWWGG 1 cut(s) 244
TasI AATT 1 cut(s) 23
TatI WGTACW 1 cut(s) 103
TfiI GAWTC 2 cut(s) 82, 88
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TscAI CASTG 1 cut(s) 219
TseI GCWGC 2 cut(s) 119, 157
TspRI CASTG 1 cut(s) 219
Vha464I CTTAAG 1 cut(s) 188
XapI RAATTY 1 cut(s) 23
XmnI GAANNNNTTC 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.