Rh7DG475800

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
67981965 .. 67982408
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG475800.1

Sequence Viewer

Length: 270 bp
ATGTCCGAGCAAGAACAACTGAAATTCCAATCCCCAAGAAAGCTTATGCTTCTACAACTATGTTGGAGGCAAGTTGCATGGAATCTGATTCCTATTTCAGAAGTACAAGATGTAGTAGCTGCATATAGAAAGGACATGGAGTGGCAGACAAGTAAGCTGCTTCTTCCACACAAGAAAATGTGTGATCTTAAGAAGGTGCAAGTTGATGTTGTAGTCATTGAGTCAGATAATGTGGCAAATGCAATAGCAGAGTTTCTAAGTCTGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.37

Weight (kDa)

6.55

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023141)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0020076.1_g000002
rosa_samantha Rh7BG464400 Rh7CG508300 Rh7DG475800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 23
AfaI GTAC 1 cut(s) 105
AflII CTTAAG 1 cut(s) 188
AluBI AGCT 3 cut(s) 43, 119, 157
AluI AGCT 3 cut(s) 43, 119, 157
ApeKI GCWGC 2 cut(s) 119, 157
ApoI RAATTY 1 cut(s) 23
BbvI GCAGC 2 cut(s) 106, 144
BfrI CTTAAG 1 cut(s) 188
BisI GCNGC 2 cut(s) 120, 158
BlsI GCNGC 2 cut(s) 121, 159
BseXI GCAGC 2 cut(s) 106, 144
Bsp143I GATC 1 cut(s) 184
BspTI CTTAAG 1 cut(s) 188
BssMI GATC 1 cut(s) 184
BstAFI CTTAAG 1 cut(s) 188
BstDEI CTNAG 1 cut(s) 257
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstV1I GCAGC 2 cut(s) 106, 144
Csp6I GTAC 1 cut(s) 104
CviAII CATG 2 cut(s) 78, 136
CviJI RGCY 3 cut(s) 43, 119, 157
CviKI_1 RGCY 3 cut(s) 43, 119, 157
CviQI GTAC 1 cut(s) 104
DdeI CTNAG 1 cut(s) 257
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
FaeI CATG 2 cut(s) 81, 139
FaiI YATR 7 cut(s) 47, 61, 79, 124, 126, 137, 268
FatI CATG 2 cut(s) 77, 135
Fnu4HI GCNGC 2 cut(s) 120, 158
Fsp4HI GCNGC 2 cut(s) 120, 158
GluI GCNGC 2 cut(s) 120, 158
Hin1II CATG 2 cut(s) 81, 139
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 3 cut(s) 82, 88, 221
Hpy188I TCNGA 4 cut(s) 7, 87, 100, 226
HpyAV CCTTC 1 cut(s) 187
HpyCH4V TGCA 4 cut(s) 77, 122, 199, 242
HpyF3I CTNAG 1 cut(s) 257
Hsp92II CATG 2 cut(s) 81, 139
Kzo9I GATC 1 cut(s) 184
Lsp1109I GCAGC 2 cut(s) 106, 144
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 1 cut(s) 155
MluCI AATT 1 cut(s) 23
MlyI GAGTC 1 cut(s) 230
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 1 cut(s) 60
MseI TTAA 1 cut(s) 189
MspCI CTTAAG 1 cut(s) 188
NdeII GATC 1 cut(s) 184
NlaIII CATG 2 cut(s) 81, 139
PfeI GAWTC 2 cut(s) 82, 88
PkrI GCNGC 2 cut(s) 121, 159
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 189
SatI GCNGC 2 cut(s) 120, 158
Sau3AI GATC 1 cut(s) 184
SchI GAGTC 1 cut(s) 230
SetI ASST 4 cut(s) 45, 121, 159, 198
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
Sse9I AATT 1 cut(s) 23
TasI AATT 1 cut(s) 23
TatI WGTACW 1 cut(s) 103
TfiI GAWTC 2 cut(s) 82, 88
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TseI GCWGC 2 cut(s) 119, 157
Vha464I CTTAAG 1 cut(s) 188
XapI RAATTY 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.