Rmu_sc0032088.1_g000001

FAD binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032088.1
OG0021627
Physical Location & Seq
Forward (+)
1 .. 841
841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032088.1_g000001.1.cds

Sequence Viewer

Length: 545 bp
cttcaagtattatacccctgacgggttgaaaggccttgaccatgaaccccttgaggcaaggcaaatattgatgggctataaatgtgtttccatcaatgccagtgatgatattgtttccgtgactgcatcttttctcaaggatgggaaacatatggagaggaatatcagatgcaatatggttgtaggtactgacggtgctggaagtaatgtacgtaagctggctggtatagatatgagaggtgaaaaggacttgcagaagcttgtgagtttccatttcttgagcagagaccttggaaattacttgcacagtgagagacctggcatgctgttttttatcttcaatactgaagctataggggtcctcgttgcacatgatctcaagcaaggggaatttgtattgcagatgccattttatccaccccagcaaaaccttgaagatttcagtcccaagacatgtgagaggatgattttcaaattggtaggtcgagagcttggagacataaatgtgattgacataaaaccttgggtgatgcatgctgaagttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3

Protein Analysis

181

Amino Acids

20.52

Weight (kDa)

6.08

Isoelectric Point (pI)

25.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021627)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000187.1_g000011 Rmu_sc0012044.1_g000001 Rmu_sc0032088.1_g000001
rosa_samantha Rh2AG081900 Rh2DG081000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 390
AcuI CTGAAG 1 cut(s) 367
AfaI GTAC 2 cut(s) 188, 211
AfiI CCNNNNNNNGG 1 cut(s) 22
AflIII ACRYGT 1 cut(s) 453
AgsI TTSAA 5 cut(s) 5, 29, 341, 435, 473
AjnI CCWGG 1 cut(s) 317
AluBI AGCT 4 cut(s) 218, 260, 351, 491
AluI AGCT 4 cut(s) 218, 260, 351, 491
Alw26I GTCTC 3 cut(s) 280, 308, 490
AoxI GGCC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 390
AspS9I GGNCC 1 cut(s) 359
AsuHPI GGTGA 2 cut(s) 252, 539
AvaII GGWCC 1 cut(s) 359
BccI CCATC 3 cut(s) 65, 99, 135
BciT130I CCWGG 1 cut(s) 319
BcoDI GTCTC 3 cut(s) 280, 308, 490
BfmI CTRYAG 1 cut(s) 352
Bme1390I CCNGG 1 cut(s) 319
Bme18I GGWCC 1 cut(s) 359
BmgT120I GGNCC 1 cut(s) 359
BmiI GGNNCC 1 cut(s) 360
BmrFI CCNGG 1 cut(s) 319
BmsI GCATC 4 cut(s) 135, 159, 394, 520
BpuEI CTTGAG 4 cut(s) 72, 120, 299, 363
BsaAI YACGTR 1 cut(s) 213
BsaI GGTCTC 2 cut(s) 280, 308
BsaJI CCNNGG 2 cut(s) 290, 522
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 319
BseDI CCNNGG 2 cut(s) 290, 522
BseGI GGATG 2 cut(s) 146, 469
BseLI CCNNNNNNNGG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 100
BseYI CCCAGC 1 cut(s) 421
BshFI GGCC 1 cut(s) 34
BslFI GGGAC 1 cut(s) 430
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 3 cut(s) 280, 308, 490
BsmFI GGGAC 1 cut(s) 430
BsnI GGCC 1 cut(s) 34
Bso31I GGTCTC 2 cut(s) 280, 308
Bsp143I GATC 1 cut(s) 374
BspANI GGCC 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 360
BspTNI GGTCTC 2 cut(s) 280, 308
BsrI ACTGG 1 cut(s) 100
BssECI CCNNGG 2 cut(s) 290, 522
BssMI GATC 1 cut(s) 374
BssT1I CCWWGG 2 cut(s) 290, 522
Bst2UI CCWGG 1 cut(s) 319
Bst4CI ACNGT 2 cut(s) 195, 309
BstBAI YACGTR 1 cut(s) 213
BstC8I GCNNGC 3 cut(s) 220, 324, 535
BstF5I GGATG 2 cut(s) 146, 469
BstKTI GATC 1 cut(s) 377
BstMAI GTCTC 3 cut(s) 280, 308, 490
BstMBI GATC 1 cut(s) 374
BstNI CCWGG 1 cut(s) 319
BstNSI RCATGY 3 cut(s) 326, 457, 537
BstSCI CCNGG 1 cut(s) 317
BstSFI CTRYAG 1 cut(s) 352
BstSNI TACGTA 1 cut(s) 213
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 2 cut(s) 146, 469
BtsIMutI CAGTG 2 cut(s) 107, 314
Cac8I GCNNGC 3 cut(s) 220, 324, 535
Cfr13I GGNCC 1 cut(s) 359
Csp6I GTAC 2 cut(s) 187, 210
CviAII CATG 5 cut(s) 42, 323, 372, 454, 534
CviJI RGCY 7 cut(s) 34, 76, 218, 222, 260, 351, 491
CviKI_1 RGCY 7 cut(s) 34, 76, 218, 222, 260, 351, 491
CviQI GTAC 2 cut(s) 187, 210
DpnI GATC 1 cut(s) 376
DpnII GATC 1 cut(s) 374
Eco105I TACGTA 1 cut(s) 213
Eco130I CCWWGG 2 cut(s) 290, 522
Eco147I AGGCCT 1 cut(s) 34
Eco31I GGTCTC 2 cut(s) 280, 308
Eco47I GGWCC 1 cut(s) 359
Eco57I CTGAAG 1 cut(s) 367
EcoO109I RGGNCCY 1 cut(s) 359
EcoRII CCWGG 1 cut(s) 317
EcoT14I CCWWGG 2 cut(s) 290, 522
EcoT22I ATGCAT 1 cut(s) 535
ErhI CCWWGG 2 cut(s) 290, 522
FaeI CATG 5 cut(s) 45, 326, 375, 457, 537
FaqI GGGAC 1 cut(s) 430
FatI CATG 5 cut(s) 41, 322, 371, 453, 533
FauNDI CATATG 1 cut(s) 151
FokI GGATG 2 cut(s) 153, 476
GsaI CCCAGC 1 cut(s) 425
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 5 cut(s) 45, 326, 375, 457, 537
HindIII AAGCTT 1 cut(s) 258
HphI GGTGA 2 cut(s) 252, 539
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 2 cut(s) 278, 486
HpyCH4III ACNGT 2 cut(s) 195, 309
HpyCH4IV ACGT 1 cut(s) 212
HpyCH4V TGCA 7 cut(s) 126, 172, 254, 305, 369, 401, 533
HpySE526I ACGT 1 cut(s) 212
Hsp92II CATG 5 cut(s) 45, 326, 375, 457, 537
Kzo9I GATC 1 cut(s) 374
LpnPI CCDG 8 cut(s) 31, 113, 184, 204, 208, 304, 331, 435
LweI GCATC 4 cut(s) 135, 159, 394, 520
MaeII ACGT 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 119
MalI GATC 1 cut(s) 376
MboI GATC 1 cut(s) 374
MboII GAAGA 2 cut(s) 329, 447
MluCI AATT 3 cut(s) 296, 390, 474
MnlI CCTC 5 cut(s) 47, 151, 231, 372, 454
Mph1103I ATGCAT 1 cut(s) 535
MslI CAYNNNNRTG 1 cut(s) 504
MspR9I CCNGG 1 cut(s) 319
MvaI CCWGG 1 cut(s) 319
NdeI CATATG 1 cut(s) 151
NdeII GATC 1 cut(s) 374
NlaIII CATG 5 cut(s) 45, 326, 375, 457, 537
NlaIV GGNNCC 1 cut(s) 360
NmuCI GTSAC 1 cut(s) 119
NsiI ATGCAT 1 cut(s) 535
NspI RCATGY 3 cut(s) 326, 457, 537
PaeI GCATGC 2 cut(s) 326, 537
PceI AGGCCT 1 cut(s) 34
PciI ACATGT 1 cut(s) 453
Ppu21I YACGTR 1 cut(s) 213
PpuMI RGGWCCY 1 cut(s) 359
PscI ACATGT 1 cut(s) 453
Psp5II RGGWCCY 1 cut(s) 359
Psp6I CCWGG 1 cut(s) 317
PspFI CCCAGC 1 cut(s) 421
PspGI CCWGG 1 cut(s) 317
PspN4I GGNNCC 1 cut(s) 360
PspPI GGNCC 1 cut(s) 359
PspPPI RGGWCCY 1 cut(s) 359
RsaI GTAC 2 cut(s) 188, 211
RsaNI GTAC 2 cut(s) 187, 210
RseI CAYNNNNRTG 1 cut(s) 504
Sau3AI GATC 1 cut(s) 374
Sau96I GGNCC 1 cut(s) 359
ScrFI CCNGG 1 cut(s) 319
SfaNI GCATC 4 cut(s) 135, 159, 394, 520
SfcI CTRYAG 1 cut(s) 352
SinI GGWCC 1 cut(s) 359
SmiMI CAYNNNNRTG 1 cut(s) 504
SmlI CTYRAG 4 cut(s) 51, 135, 278, 378
SmoI CTYRAG 4 cut(s) 51, 135, 278, 378
SnaBI TACGTA 1 cut(s) 213
SphI GCATGC 2 cut(s) 326, 537
Sse9I AATT 3 cut(s) 296, 390, 474
SseBI AGGCCT 1 cut(s) 34
SspI AATATT 1 cut(s) 67
StuI AGGCCT 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 317
StyI CCWWGG 2 cut(s) 290, 522
TaaI ACNGT 2 cut(s) 195, 309
TaiI ACGT 1 cut(s) 215
TaqI TCGA 1 cut(s) 485
TasI AATT 3 cut(s) 296, 390, 474
TscAI CASTG 2 cut(s) 107, 314
TseFI GTSAC 1 cut(s) 119
Tsp45I GTSAC 1 cut(s) 119
TspDTI ATGAA 1 cut(s) 58
TspGWI ACGGA 1 cut(s) 107
TspRI CASTG 2 cut(s) 107, 314
VpaK11BI GGWCC 1 cut(s) 359
XapI RAATTY 1 cut(s) 390
XceI RCATGY 3 cut(s) 326, 457, 537
Zsp2I ATGCAT 1 cut(s) 535
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.