Rmu_sc0033413.1_g000001

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033413.1
Physical Location & Seq
Reverse (-)
2 .. 411
410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033413.1_g000001.1.cds

Sequence Viewer

Length: 254 bp
atgcccttggtgattcctggcttgcctccactcgacattgctgatctgcctggcatgcttaagaagccggatagtaacccagcttacttgaggatgcaactgaatcagtattcaaacttggacaaggctgattggatctttggaaatactttccgagcactagaaagcgaggctgccaaaggagtagcaaagctatggccagcgaagttgataggccctatgatcccttcagcttatttggatggtcagattaa
Functional Annotation

Protein Analysis

84

Amino Acids

9.21

Weight (kDa)

6.07

Isoelectric Point (pI)

26.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022598)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0314031
rosa_multiflora Rmu_sc0033412.1_g000001 Rmu_sc0033413.1_g000001
rosa_samantha Rh1AG008300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 143, 217
AcoI YGGCCR 1 cut(s) 197
AcuI CTGAAG 1 cut(s) 213
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 114
AjnI CCWGG 2 cut(s) 16, 49
AluBI AGCT 3 cut(s) 83, 193, 233
AluI AGCT 3 cut(s) 83, 193, 233
Alw21I GWGCWC 1 cut(s) 160
AlwI GGATC 2 cut(s) 143, 217
AoxI GGCC 2 cut(s) 197, 214
ApeKI GCWGC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 22
BalI TGGCCA 1 cut(s) 199
Bbv12I GWGCWC 1 cut(s) 160
BbvI GCAGC 1 cut(s) 160
BccI CCATC 1 cut(s) 236
BciT130I CCWGG 2 cut(s) 18, 51
BfaI CTAG 1 cut(s) 161
BfrI CTTAAG 1 cut(s) 59
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
Bme1390I CCNGG 2 cut(s) 18, 51
BmgT120I GGNCC 1 cut(s) 215
BmrFI CCNGG 2 cut(s) 18, 51
BmsI GCATC 1 cut(s) 84
BpuEI CTTGAG 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 6
Bse3DI GCAATG 1 cut(s) 36
BseBI CCWGG 2 cut(s) 18, 51
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 2 cut(s) 99, 247
BseMI GCAATG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 160
BseYI CCCAGC 1 cut(s) 79
BshFI GGCC 2 cut(s) 199, 216
BsiHKAI GWGCWC 1 cut(s) 160
BsiSI CCGG 1 cut(s) 68
BsnI GGCC 2 cut(s) 199, 216
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 3 cut(s) 43, 135, 222
BspANI GGCC 2 cut(s) 199, 216
BspPI GGATC 2 cut(s) 143, 217
BspTI CTTAAG 1 cut(s) 59
BsrDI GCAATG 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 3 cut(s) 43, 135, 222
BssT1I CCWWGG 1 cut(s) 6
Bst2UI CCWGG 2 cut(s) 18, 51
BstAFI CTTAAG 1 cut(s) 59
BstC8I GCNNGC 3 cut(s) 23, 56, 201
BstF5I GGATG 2 cut(s) 99, 247
BstKTI GATC 3 cut(s) 46, 138, 225
BstMBI GATC 3 cut(s) 43, 135, 222
BstMWI GCNNNNNNNGC 2 cut(s) 55, 64
BstNI CCWGG 2 cut(s) 18, 51
BstNSI RCATGY 1 cut(s) 58
BstSCI CCNGG 2 cut(s) 16, 49
BstV1I GCAGC 1 cut(s) 160
BstX2I RGATCY 1 cut(s) 135
BstYI RGATCY 1 cut(s) 135
BsuRI GGCC 2 cut(s) 199, 216
BtsCI GGATG 2 cut(s) 99, 247
Cac8I GCNNGC 3 cut(s) 23, 56, 201
Cfr13I GGNCC 1 cut(s) 215
CviAII CATG 1 cut(s) 55
CviJI RGCY 9 cut(s) 21, 67, 83, 128, 173, 193, 199, 216, 233
CviKI_1 RGCY 9 cut(s) 21, 67, 83, 128, 173, 193, 199, 216, 233
DpnI GATC 3 cut(s) 45, 137, 224
DpnII GATC 3 cut(s) 43, 135, 222
EaeI YGGCCR 1 cut(s) 197
Eco130I CCWWGG 1 cut(s) 6
Eco57I CTGAAG 1 cut(s) 213
EcoO109I RGGNCCY 1 cut(s) 215
EcoRII CCWGG 2 cut(s) 16, 49
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 58
FaiI YATR 3 cut(s) 56, 196, 221
FatI CATG 1 cut(s) 54
Fnu4HI GCNGC 1 cut(s) 174
FokI GGATG 1 cut(s) 106
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 1 cut(s) 161
GluI GCNGC 1 cut(s) 174
GsaI CCCAGC 1 cut(s) 83
HaeIII GGCC 2 cut(s) 199, 216
HapII CCGG 1 cut(s) 68
Hin1II CATG 1 cut(s) 58
HinfI GANTC 2 cut(s) 13, 103
HpaII CCGG 1 cut(s) 68
HphI GGTGA 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 155, 249
HpyAV CCTTC 1 cut(s) 237
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 2 cut(s) 55, 64
Hsp92II CATG 1 cut(s) 58
Kzo9I GATC 3 cut(s) 43, 135, 222
LpnPI CCDG 7 cut(s) 3, 30, 36, 63, 81, 93, 213
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 1 cut(s) 84
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 74
MalI GATC 3 cut(s) 45, 137, 224
MboI GATC 3 cut(s) 43, 135, 222
MflI RGATCY 1 cut(s) 135
MhlI GDGCHC 1 cut(s) 160
MlsI TGGCCA 1 cut(s) 199
MluNI TGGCCA 1 cut(s) 199
MnlI CCTC 3 cut(s) 36, 84, 163
Mox20I TGGCCA 1 cut(s) 199
MscI TGGCCA 1 cut(s) 199
MseI TTAA 2 cut(s) 60, 252
Msp20I TGGCCA 1 cut(s) 199
MspCI CTTAAG 1 cut(s) 59
MspI CCGG 1 cut(s) 68
MspR9I CCNGG 2 cut(s) 18, 51
MvaI CCWGG 2 cut(s) 18, 51
MwoI GCNNNNNNNGC 2 cut(s) 55, 64
NdeII GATC 3 cut(s) 43, 135, 222
NlaIII CATG 1 cut(s) 58
NspI RCATGY 1 cut(s) 58
PaeI GCATGC 1 cut(s) 58
PfeI GAWTC 2 cut(s) 13, 103
PkrI GCNGC 1 cut(s) 175
Psp6I CCWGG 2 cut(s) 16, 49
PspFI CCCAGC 1 cut(s) 79
PspGI CCWGG 2 cut(s) 16, 49
PspPI GGNCC 1 cut(s) 215
PsuI RGATCY 1 cut(s) 135
SaqAI TTAA 2 cut(s) 60, 252
SatI GCNGC 1 cut(s) 174
Sau3AI GATC 3 cut(s) 43, 135, 222
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 2 cut(s) 18, 51
SduI GDGCHC 1 cut(s) 160
SetI ASST 3 cut(s) 85, 195, 235
SfaNI GCATC 1 cut(s) 84
SmlI CTYRAG 2 cut(s) 59, 88
SmoI CTYRAG 2 cut(s) 59, 88
SphI GCATGC 1 cut(s) 58
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 2 cut(s) 16, 49
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 1 cut(s) 33
TfiI GAWTC 2 cut(s) 13, 103
Tru1I TTAA 2 cut(s) 60, 252
Tru9I TTAA 2 cut(s) 60, 252
TseI GCWGC 1 cut(s) 173
Vha464I CTTAAG 1 cut(s) 59
XceI RCATGY 1 cut(s) 58
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.