Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037281.1

Orthogroup ID

OG0005663

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1547

Gene Structure 1546 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037281.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 443 bp

gtcggagtccctgatgaattcatatataatacaagtttaatcctttttccatcctctctcgtagaaacttttgcatggaagaaagctataacatcgggcccaccaccatctcctcgcgacagccatacttgctcatcttcaaagaacaaagtgattgtgattggtggtgaagatgggcatgattactatttgtctgatgtccatattcttgatgcagatactctagtgtggagggagctgaacacttctggccaatccttgccaccccgaggtggtcactctactgttgcttttggaaagaacttatttgttttcgggggattcacagacgcacaaagtctatacaatgatctctacatgcttgatgttgatactggcgtatggacaaaggttatcactacaggtgacggaccttctgctagattttctgttgctggggactg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_4 Kelch_5

Protein Analysis

147

Amino Acids

15.86

Weight (kDa)

4.85

Isoelectric Point (pI)

38.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005663)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18610 AT1G18610 AT1G74150 AT1G74150 AT1G74150 AT1G74150 AT1G74150 AT1G74150
fragaria_vesca	FvH4_5g13650 FvH4_5g13650 FvH4_5g13650 FvH4_5g13650
malus_domestica	MD06G1203300.v1.1 MD14G1213900.v1.1
prunus_persica	Prupe.5G207100_v2.0.a1
pyrus_communis	pycom06g18120 pycom14g17730
rosa_chinensis	RchiOBHm_Chr7g0183311
rosa_laevigata	RLG00000005058
rosa_multiflora	Rmu_sc0008744.1_g000001 Rmu_sc0037281.1_g000001
rosa_roxburghii	Rroxscaffold_3G00270580
rosa_rugosa	Rorug06G0456400
rosa_samantha	Rh7AG058000 Rh7BG057800 Rh7CG059400 Rh7DG057600
rosa_wichuraiana	Rw7G004760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	117
AcoI	YGGCCR	1 cut(s)	250
AcsI	RAATTY	1 cut(s)	17
AfiI	CCNNNNNNNGG	2 cut(s)	269, 272
AgsI	TTSAA	1 cut(s)	141
AluBI	AGCT	2 cut(s)	86, 238
AluI	AGCT	2 cut(s)	86, 238
Ama87I	CYCGRG	1 cut(s)	267
AoxI	GGCC	2 cut(s)	97, 250
ApaI	GGGCCC	1 cut(s)	101
ApoI	RAATTY	1 cut(s)	17
AspS9I	GGNCC	3 cut(s)	97, 98, 410
AsuHPI	GGTGA	2 cut(s)	179, 416
AvaI	CYCGRG	1 cut(s)	267
AvaII	GGWCC	1 cut(s)	410
BaeGI	GKGCMC	1 cut(s)	101
BaeI	ACNNNNGTAYC	4 cut(s)	210, 243, 363, 396
BalI	TGGCCA	1 cut(s)	252
BanII	GRGCYC	1 cut(s)	101
BccI	CCATC	3 cut(s)	58, 115, 167
BfaI	CTAG	2 cut(s)	224, 420
BfmI	CTRYAG	1 cut(s)	399
Bme18I	GGWCC	1 cut(s)	410
BmeT110I	CYCGRG	1 cut(s)	267
BmgT120I	GGNCC	3 cut(s)	97, 98, 410
BmiI	GGNNCC	1 cut(s)	99
BmsI	GCATC	1 cut(s)	202
BsaJI	CCNNGG	1 cut(s)	268
Bsc4I	CCNNNNNNNGG	2 cut(s)	269, 272
Bse1I	ACTGG	1 cut(s)	379
BseDI	CCNNGG	1 cut(s)	268
BseGI	GGATG	1 cut(s)	50
BseLI	CCNNNNNNNGG	2 cut(s)	269, 272
BseNI	ACTGG	1 cut(s)	379
BseRI	GAGGAG	1 cut(s)	102
BseSI	GKGCMC	1 cut(s)	101
BseYI	CCCAGC	1 cut(s)	434
Bsh1236I	CGCG	1 cut(s)	117
BshFI	GGCC	2 cut(s)	99, 252
BsiHKCI	CYCGRG	1 cut(s)	267
BslI	CCNNNNNNNGG	2 cut(s)	269, 272
BsnI	GGCC	2 cut(s)	99, 252
BsoBI	CYCGRG	1 cut(s)	267
Bsp120I	GGGCCC	1 cut(s)	97
Bsp1286I	GDGCHC	1 cut(s)	101
Bsp143I	GATC	1 cut(s)	349
Bsp68I	TCGCGA	1 cut(s)	117
BspANI	GGCC	2 cut(s)	99, 252
BspFNI	CGCG	1 cut(s)	117
BspLI	GGNNCC	1 cut(s)	99
BsrI	ACTGG	1 cut(s)	379
BssECI	CCNNGG	1 cut(s)	268
BssMI	GATC	1 cut(s)	349
Bst4CI	ACNGT	1 cut(s)	286
BstF5I	GGATG	1 cut(s)	50
BstFNI	CGCG	1 cut(s)	117
BstKTI	GATC	1 cut(s)	352
BstMBI	GATC	1 cut(s)	349
BstMWI	GCNNNNNNNGC	1 cut(s)	129
BstNSI	RCATGY	1 cut(s)	361
BstSFI	CTRYAG	1 cut(s)	399
BstSLI	GKGCMC	1 cut(s)	101
BstUI	CGCG	1 cut(s)	117
BsuRI	GGCC	2 cut(s)	99, 252
BtsCI	GGATG	1 cut(s)	50
BtuMI	TCGCGA	1 cut(s)	117
Cfr13I	GGNCC	3 cut(s)	97, 98, 410
CseI	GACGC	1 cut(s)	338
CviAII	CATG	3 cut(s)	75, 179, 358
CviJI	RGCY	5 cut(s)	86, 99, 123, 238, 252
CviKI_1	RGCY	5 cut(s)	86, 99, 123, 238, 252
DpnI	GATC	1 cut(s)	351
DpnII	GATC	1 cut(s)	349
EaeI	YGGCCR	1 cut(s)	250
Eco24I	GRGCYC	1 cut(s)	101
Eco47I	GGWCC	1 cut(s)	410
Eco88I	CYCGRG	1 cut(s)	267
EcoRI	GAATTC	1 cut(s)	17
EcoT38I	GRGCYC	1 cut(s)	101
FaeI	CATG	3 cut(s)	78, 182, 361
FatI	CATG	3 cut(s)	74, 178, 357
FokI	GGATG	1 cut(s)	37
FriOI	GRGCYC	1 cut(s)	101
FspBI	CTAG	2 cut(s)	224, 420
GsaI	CCCAGC	1 cut(s)	438
HaeIII	GGCC	2 cut(s)	99, 252
HgaI	GACGC	1 cut(s)	338
Hin1II	CATG	3 cut(s)	78, 182, 361
HinfI	GANTC	2 cut(s)	6, 321
HphI	GGTGA	2 cut(s)	179, 416
Hpy188I	TCNGA	2 cut(s)	5, 196
Hpy188III	TCNNGA	2 cut(s)	116, 209
HpyAV	CCTTC	1 cut(s)	423
HpyCH4III	ACNGT	1 cut(s)	286
HpyCH4V	TGCA	2 cut(s)	74, 215
HpyF10VI	GCNNNNNNNGC	1 cut(s)	129
Hsp92II	CATG	3 cut(s)	78, 182, 361
Kzo9I	GATC	1 cut(s)	349
LmnI	GCTCC	1 cut(s)	235
LpnPI	CCDG	5 cut(s)	24, 234, 360, 387, 420
LweI	GCATC	1 cut(s)	202
MaeI	CTAG	2 cut(s)	224, 420
MaeIII	GTNAC	2 cut(s)	275, 404
MalI	GATC	1 cut(s)	351
MboI	GATC	1 cut(s)	349
MboII	GAAGA	3 cut(s)	91, 129, 182
MhlI	GDGCHC	1 cut(s)	101
MlsI	TGGCCA	1 cut(s)	252
MluCI	AATT	1 cut(s)	17
MluNI	TGGCCA	1 cut(s)	252
MlyI	GAGTC	1 cut(s)	15
MnlI	CCTC	4 cut(s)	64, 123, 225, 263
Mox20I	TGGCCA	1 cut(s)	252
MscI	TGGCCA	1 cut(s)	252
MseI	TTAA	1 cut(s)	38
Msp20I	TGGCCA	1 cut(s)	252
MvnI	CGCG	1 cut(s)	117
MwoI	GCNNNNNNNGC	1 cut(s)	129
NdeII	GATC	1 cut(s)	349
NlaIII	CATG	3 cut(s)	78, 182, 361
NlaIV	GGNNCC	1 cut(s)	99
NmuCI	GTSAC	2 cut(s)	275, 404
NruI	TCGCGA	1 cut(s)	117
NspI	RCATGY	1 cut(s)	361
PfeI	GAWTC	1 cut(s)	321
PleI	GAGTC	1 cut(s)	14
PpsI	GAGTC	1 cut(s)	14
PspFI	CCCAGC	1 cut(s)	434
PspN4I	GGNNCC	1 cut(s)	99
PspOMI	GGGCCC	1 cut(s)	97
PspPI	GGNCC	3 cut(s)	97, 98, 410
RruI	TCGCGA	1 cut(s)	117
SaqAI	TTAA	1 cut(s)	38
Sau3AI	GATC	1 cut(s)	349
Sau96I	GGNCC	3 cut(s)	97, 98, 410
SchI	GAGTC	1 cut(s)	15
SduI	GDGCHC	1 cut(s)	101
SetI	ASST	6 cut(s)	88, 240, 274, 393, 406, 415
SfaNI	GCATC	1 cut(s)	202
SfcI	CTRYAG	1 cut(s)	399
SinI	GGWCC	1 cut(s)	410
Sse9I	AATT	1 cut(s)	17
SspMI	CTAG	2 cut(s)	224, 420
TaaI	ACNGT	1 cut(s)	286
TasI	AATT	1 cut(s)	17
TfiI	GAWTC	1 cut(s)	321
Tru1I	TTAA	1 cut(s)	38
Tru9I	TTAA	1 cut(s)	38
TseFI	GTSAC	2 cut(s)	275, 404
Tsp45I	GTSAC	2 cut(s)	275, 404
TspDTI	ATGAA	2 cut(s)	10, 30
TspGWI	ACGGA	1 cut(s)	423
VpaK11BI	GGWCC	1 cut(s)	410
XapI	RAATTY	1 cut(s)	17
XceI	RCATGY	1 cut(s)	361
XspI	CTAG	2 cut(s)	224, 420

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.