Rmu_ssc0000160.1_g000010

Glycine-rich cell wall structural protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000160.1
Physical Location & Seq
Reverse (-)
56525 .. 57205
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000160.1_g000010.1.cds

Sequence Viewer

Length: 681 bp
atggatacactgagaaacttatgggctatcttgtttatttcgatagccattgttggtttgcaaggtgatggtaaggtggagaatgttactgctaatagtcaagtaggcaacgctagttctctagctcttgctttcgatcaaggcaacaaaacagaagctagaaacaagagcgcttcttacactactgaagttgttatcaacagcaaaaacaaacactcttggatgaatagaggaagaggaggtggcggcggtggtggaggagggggaggaggtggtggccgtggtagtggtagtggtagtgggggtggcggaggcggtggaggaggaggctactcgtggagttggggtggtggaggtggaggtggaggtggaggcggtaggcgaggtggcggtgggggaggtagtggttggggatggggtggaggaggaggtgggagtgggtggtggaagtggggttgcggaggccaaggcggcggaaacggaggaggtaaaaggcatcatcatagtgtgtatcgggggacagggaggttcagtgaggatcattacaagctaggagagtttgcacaatgcatgcgtaaagggcggtgcaaagggatgagattggactgccctcttcactgtggaggaccttgctactatgactgccaagatatgtgcaaggctcactgtcgacgtcgatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

226

Amino Acids

22.62

Weight (kDa)

9.76

Isoelectric Point (pI)

53.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017517)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G75550 AT1G75550
fragaria_vesca FvH4_2g39010
malus_domestica MD15G1017600.v1.1
prunus_persica Prupe.1G370900_v2.0.a1
pyrus_communis pycom15g01550
rosa_chinensis RchiOBHm_Chr6g0302111
rosa_laevigata RLG00000011194
rosa_multiflora Rmu_ssc0000160.1_g000010
rosa_roxburghii Rroxscaffold_7G00166070
rosa_rugosa Rorug06G0312400
rosa_wichuraiana Rw6G036790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 676
AccI GTMKAC 1 cut(s) 670
AclWI GGATC 1 cut(s) 546
AcoI YGGCCR 1 cut(s) 277
AcuI CTGAAG 1 cut(s) 207
AcyI GRCGYC 1 cut(s) 673
AfeI AGCGCT 1 cut(s) 172
AluBI AGCT 3 cut(s) 125, 158, 550
AluI AGCT 3 cut(s) 125, 158, 550
AlwI GGATC 1 cut(s) 546
Aor51HI AGCGCT 1 cut(s) 172
AoxI GGCC 2 cut(s) 277, 463
AspLEI GCGC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 626
AsuHPI GGTGA 1 cut(s) 77
AvaII GGWCC 1 cut(s) 626
BauI CACGAG 1 cut(s) 334
BccI CCATC 2 cut(s) 62, 408
BceAI ACGGC 1 cut(s) 264
BfaI CTAG 4 cut(s) 114, 122, 159, 551
BfoI RGCGCY 1 cut(s) 174
BglI GCCNNNNNGGC 1 cut(s) 471
BisI GCNGC 2 cut(s) 247, 472
BlsI GCNGC 2 cut(s) 248, 473
Bme18I GGWCC 1 cut(s) 626
BmgT120I GGNCC 1 cut(s) 626
BmsI GCATC 1 cut(s) 505
BsaHI GRCGYC 1 cut(s) 673
BsaJI CCNNGG 2 cut(s) 280, 466
BsaXI ACNNNNNCTCC 4 cut(s) 331, 361, 517, 547
BseDI CCNNGG 2 cut(s) 280, 466
BseGI GGATG 3 cut(s) 228, 419, 600
BseRI GAGGAG 8 cut(s) 252, 273, 282, 336, 339, 438, 441, 498
BshFI GGCC 2 cut(s) 279, 465
BslFI GGGAC 1 cut(s) 532
BsmFI GGGAC 1 cut(s) 532
BsnI GGCC 2 cut(s) 279, 465
Bsp143I GATC 2 cut(s) 136, 538
BspANI GGCC 2 cut(s) 279, 465
BspPI GGATC 1 cut(s) 546
BssECI CCNNGG 2 cut(s) 280, 466
BssMI GATC 2 cut(s) 136, 538
BssNI GRCGYC 1 cut(s) 673
BssSI CACGAG 1 cut(s) 334
BssT1I CCWWGG 1 cut(s) 466
Bst2BI CACGAG 1 cut(s) 334
Bst4CI ACNGT 2 cut(s) 620, 668
Bst6I CTCTTC 2 cut(s) 229, 618
BstACI GRCGYC 1 cut(s) 673
BstC8I GCNNGC 1 cut(s) 572
BstDEI CTNAG 1 cut(s) 11
BstDSI CCRYGG 1 cut(s) 280
BstF5I GGATG 3 cut(s) 228, 419, 600
BstH2I RGCGCY 1 cut(s) 174
BstHHI GCGC 1 cut(s) 173
BstKTI GATC 2 cut(s) 139, 541
BstMBI GATC 2 cut(s) 136, 538
BstMWI GCNNNNNNNGC 2 cut(s) 471, 580
BstNSI RCATGY 1 cut(s) 574
BsuRI GGCC 2 cut(s) 279, 465
BtgI CCRYGG 1 cut(s) 280
BtsCI GGATG 3 cut(s) 228, 419, 600
BtsIMutI CAGTG 4 cut(s) 8, 538, 616, 664
Cac8I GCNNGC 1 cut(s) 572
CfoI GCGC 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 626
CviAII CATG 1 cut(s) 571
CviJI RGCY 9 cut(s) 26, 47, 125, 158, 279, 330, 465, 550, 662
CviKI_1 RGCY 9 cut(s) 26, 47, 125, 158, 279, 330, 465, 550, 662
DdeI CTNAG 1 cut(s) 11
DpnI GATC 2 cut(s) 138, 540
DpnII GATC 2 cut(s) 136, 538
EaeI YGGCCR 1 cut(s) 277
Eam1104I CTCTTC 2 cut(s) 229, 618
EarI CTCTTC 2 cut(s) 229, 618
EciI GGCGGA 2 cut(s) 324, 489
Eco130I CCWWGG 1 cut(s) 466
Eco47I GGWCC 1 cut(s) 626
Eco47III AGCGCT 1 cut(s) 172
Eco57I CTGAAG 1 cut(s) 207
EcoO109I RGGNCCY 1 cut(s) 626
EcoT14I CCWWGG 1 cut(s) 466
EcoT22I ATGCAT 1 cut(s) 572
ErhI CCWWGG 1 cut(s) 466
FaeI CATG 1 cut(s) 574
FaiI YATR 5 cut(s) 22, 504, 572, 639, 653
FaqI GGGAC 1 cut(s) 532
FatI CATG 1 cut(s) 570
FblI GTMKAC 1 cut(s) 670
Fnu4HI GCNGC 2 cut(s) 247, 472
FokI GGATG 3 cut(s) 235, 426, 607
Fsp4HI GCNGC 2 cut(s) 247, 472
FspBI CTAG 4 cut(s) 114, 122, 159, 551
GlaI GCGC 1 cut(s) 172
GluI GCNGC 2 cut(s) 247, 472
HaeII RGCGCY 1 cut(s) 174
HaeIII GGCC 2 cut(s) 279, 465
HhaI GCGC 1 cut(s) 173
Hin1I GRCGYC 1 cut(s) 673
Hin1II CATG 1 cut(s) 574
Hin6I GCGC 1 cut(s) 171
HinP1I GCGC 1 cut(s) 171
HincII GTYRAC 1 cut(s) 671
HindII GTYRAC 1 cut(s) 671
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 671
Hpy8I GTNNAC 1 cut(s) 671
Hpy99I CGWCG 2 cut(s) 675, 678
HpyCH4III ACNGT 2 cut(s) 620, 668
HpyCH4IV ACGT 1 cut(s) 673
HpyCH4V TGCA 5 cut(s) 61, 563, 570, 588, 657
HpyF10VI GCNNNNNNNGC 2 cut(s) 471, 580
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 673
Hsp92I GRCGYC 1 cut(s) 673
Hsp92II CATG 1 cut(s) 574
HspAI GCGC 1 cut(s) 171
Kzo9I GATC 2 cut(s) 136, 538
LpnPI CCDG 1 cut(s) 507
LweI GCATC 1 cut(s) 505
MaeI CTAG 4 cut(s) 114, 122, 159, 551
MaeII ACGT 1 cut(s) 673
MaeIII GTNAC 1 cut(s) 85
MalI GATC 2 cut(s) 138, 540
MboI GATC 2 cut(s) 136, 538
MboII GAAGA 2 cut(s) 246, 605
Mph1103I ATGCAT 1 cut(s) 572
MslI CAYNNNNRTG 1 cut(s) 504
MwoI GCNNNNNNNGC 2 cut(s) 471, 580
NdeII GATC 2 cut(s) 136, 538
NlaIII CATG 1 cut(s) 574
NsiI ATGCAT 1 cut(s) 572
NspI RCATGY 1 cut(s) 574
PaeI GCATGC 1 cut(s) 574
PkrI GCNGC 2 cut(s) 248, 473
PpuMI RGGWCCY 1 cut(s) 626
Psp5II RGGWCCY 1 cut(s) 626
PspPI GGNCC 1 cut(s) 626
PspPPI RGGWCCY 1 cut(s) 626
RseI CAYNNNNRTG 1 cut(s) 504
SalI GTCGAC 1 cut(s) 669
SatI GCNGC 2 cut(s) 247, 472
Sau3AI GATC 2 cut(s) 136, 538
Sau96I GGNCC 1 cut(s) 626
SfaNI GCATC 1 cut(s) 505
SinI GGWCC 1 cut(s) 626
SmiMI CAYNNNNRTG 1 cut(s) 504
SphI GCATGC 1 cut(s) 574
SspMI CTAG 4 cut(s) 114, 122, 159, 551
StyI CCWWGG 1 cut(s) 466
TaaI ACNGT 2 cut(s) 620, 668
TaiI ACGT 1 cut(s) 676
TaqI TCGA 4 cut(s) 41, 135, 670, 676
TauI GCSGC 2 cut(s) 249, 474
TscAI CASTG 4 cut(s) 15, 538, 623, 671
TspDTI ATGAA 1 cut(s) 239
TspGWI ACGGA 1 cut(s) 495
TspRI CASTG 4 cut(s) 15, 538, 623, 671
VpaK11BI GGWCC 1 cut(s) 626
XceI RCATGY 1 cut(s) 574
XmiI GTMKAC 1 cut(s) 670
XspI CTAG 4 cut(s) 114, 122, 159, 551
ZraI GACGTC 1 cut(s) 674
Zsp2I ATGCAT 1 cut(s) 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.