Rmu_ssc0000177.1_g000021

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000177.1
OG0020055
Physical Location & Seq
Reverse (-)
127385 .. 127738
354 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
atgtttctgaggcgacatattgatcctaggctatgctgggagtaccttcagttgaagacacccaaagaattgtgggttgcccttaagggacattttgggaacattcatgacactttgcttccagaactggccattcagtggaatggaatccgattgctcgactataacaaggtcaatgacttcaacaagaacatgttgcgcttaaaggcacgtctcaatttctgtggaaggaaaatcacagaagatgatatgatctacaagactcttacaacctttcctacttcagcatttatactacgaaccagtataagttggagtatgacaacaaaagaatcacaaccttcaataagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

117

Amino Acids

13.85

Weight (kDa)

9.59

Isoelectric Point (pI)

46.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 138
AclWI GGATC 1 cut(s) 17
AcoI YGGCCR 1 cut(s) 129
AcuI CTGAAG 2 cut(s) 32, 267
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 138
AflII CTTAAG 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 3 cut(s) 55, 184, 345
AjiI CACGTC 1 cut(s) 212
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 1 cut(s) 17
AoxI GGCC 1 cut(s) 129
AspA2I CCTAGG 1 cut(s) 26
AspLEI GCGC 1 cut(s) 201
AvrII CCTAGG 1 cut(s) 26
BalI TGGCCA 1 cut(s) 131
BbsI GAAGAC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 218
BfaI CTAG 1 cut(s) 27
BfrI CTTAAG 1 cut(s) 83
BlnI CCTAGG 1 cut(s) 26
BmgBI CACGTC 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 62
BsaJI CCNNGG 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 132, 303
BseDI CCNNGG 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 138
BseNI ACTGG 2 cut(s) 132, 303
BseYI CCCAGC 1 cut(s) 36
BshFI GGCC 1 cut(s) 131
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 218
BsmBI CGTCTC 1 cut(s) 218
BsmFI GGGAC 1 cut(s) 102
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 2 cut(s) 22, 252
BspANI GGCC 1 cut(s) 131
BspHI TCATGA 1 cut(s) 106
BspPI GGATC 1 cut(s) 17
BspTI CTTAAG 1 cut(s) 83
BsrI ACTGG 2 cut(s) 132, 303
BssECI CCNNGG 1 cut(s) 26
BssMI GATC 2 cut(s) 22, 252
BssT1I CCWWGG 1 cut(s) 26
BstAFI CTTAAG 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 8
BstHHI GCGC 1 cut(s) 201
BstKTI GATC 2 cut(s) 25, 255
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 2 cut(s) 22, 252
BstNSI RCATGY 1 cut(s) 196
BstV2I GAAGAC 1 cut(s) 62
BsuRI GGCC 1 cut(s) 131
BtrI CACGTC 1 cut(s) 212
BtsIMutI CAGTG 1 cut(s) 143
CciI TCATGA 1 cut(s) 106
CfoI GCGC 1 cut(s) 201
Csp6I GTAC 1 cut(s) 43
CspCI CAANNNNNGTGG 2 cut(s) 205, 240
CviAII CATG 2 cut(s) 107, 193
CviJI RGCY 2 cut(s) 31, 131
CviKI_1 RGCY 2 cut(s) 31, 131
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 8
DpnI GATC 2 cut(s) 24, 254
DpnII GATC 2 cut(s) 22, 252
EaeI YGGCCR 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 26
Eco57I CTGAAG 2 cut(s) 32, 267
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
Esp3I CGTCTC 1 cut(s) 218
FaeI CATG 2 cut(s) 110, 196
FaiI YATR 9 cut(s) 18, 34, 108, 165, 194, 251, 293, 308, 320
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 106, 192
FspBI CTAG 1 cut(s) 27
GlaI GCGC 1 cut(s) 200
GsaI CCCAGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 131
HhaI GCGC 1 cut(s) 201
Hin1II CATG 2 cut(s) 110, 196
Hin6I GCGC 1 cut(s) 199
HinP1I GCGC 1 cut(s) 199
HinfI GANTC 3 cut(s) 147, 262, 332
Hpy188I TCNGA 2 cut(s) 9, 152
Hpy188III TCNNGA 2 cut(s) 107, 122
HpyAV CCTTC 3 cut(s) 56, 222, 351
HpyCH4IV ACGT 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 8
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 2 cut(s) 110, 196
HspAI GCGC 1 cut(s) 199
Kzo9I GATC 2 cut(s) 22, 252
LpnPI CCDG 4 cut(s) 22, 113, 135, 316
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 211
MalI GATC 2 cut(s) 24, 254
MboI GATC 2 cut(s) 22, 252
MboII GAAGA 2 cut(s) 67, 254
MlsI TGGCCA 1 cut(s) 131
MluCI AATT 2 cut(s) 68, 217
MluNI TGGCCA 1 cut(s) 131
MlyI GAGTC 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 293
MnlI CCTC 1 cut(s) 3
Mox20I TGGCCA 1 cut(s) 131
MscI TGGCCA 1 cut(s) 131
MseI TTAA 2 cut(s) 84, 203
Msp20I TGGCCA 1 cut(s) 131
MspCI CTTAAG 1 cut(s) 83
NdeII GATC 2 cut(s) 22, 252
NlaIII CATG 2 cut(s) 110, 196
NspI RCATGY 1 cut(s) 196
PagI TCATGA 1 cut(s) 106
PciI ACATGT 1 cut(s) 192
PfeI GAWTC 2 cut(s) 147, 332
PflMI CCANNNNNTGG 1 cut(s) 138
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
PscI ACATGT 1 cut(s) 192
PspFI CCCAGC 1 cut(s) 36
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 84, 203
Sau3AI GATC 2 cut(s) 22, 252
SchI GAGTC 1 cut(s) 256
SetI ASST 5 cut(s) 48, 174, 214, 275, 343
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 2 cut(s) 68, 217
SspMI CTAG 1 cut(s) 27
StyI CCWWGG 1 cut(s) 26
TaiI ACGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 159
TasI AATT 2 cut(s) 68, 217
TfiI GAWTC 2 cut(s) 147, 332
Tru1I TTAA 2 cut(s) 84, 203
Tru9I TTAA 2 cut(s) 84, 203
TscAI CASTG 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 95
TspRI CASTG 1 cut(s) 143
Van91I CCANNNNNTGG 1 cut(s) 138
Vha464I CTTAAG 1 cut(s) 83
XceI RCATGY 1 cut(s) 196
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.