Rroxscaffold_175G00432500

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000175
Physical Location & Seq
Reverse (-)
1253077 .. 1254641
1565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_175G00432500.1

Sequence Viewer

Length: 216 bp
ATGCAAAGTAGTGTGTTGGTGTATTCAAGTGATGAGAAGGATAGGCCAACAATGAGGCAGGTTGTTCAAATTCTTAAGGGAGTTTTAGATGTTAGTGTACCTCCAATCCCACAGCTCCTCCAGCGCCTTACAAGTATAGTGGAAGTCATTAACTTCCAGGAGACTACTTCCTGTTCAGATTCGTGGTCTCATGATGTCTCCAATGTGCATGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

71

Amino Acids

7.94

Weight (kDa)

5.0

Isoelectric Point (pI)

40.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019776)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 69
AfaI GTAC 1 cut(s) 99
AflII CTTAAG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 27, 68
AjnI CCWGG 1 cut(s) 156
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw26I GTCTC 3 cut(s) 155, 192, 202
AoxI GGCC 1 cut(s) 44
ApoI RAATTY 1 cut(s) 69
AspLEI GCGC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 158
BcoDI GTCTC 3 cut(s) 155, 192, 202
BfoI RGCGCY 1 cut(s) 127
BfrI CTTAAG 1 cut(s) 74
BfuAI ACCTGC 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 104
BsaI GGTCTC 1 cut(s) 192
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
BseBI CCWGG 1 cut(s) 158
BseRI GAGGAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 46
BsmAI GTCTC 3 cut(s) 155, 192, 202
BsnI GGCC 1 cut(s) 46
Bso31I GGTCTC 1 cut(s) 192
BspANI GGCC 1 cut(s) 46
BspHI TCATGA 1 cut(s) 190
BspMI ACCTGC 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 74
BspTNI GGTCTC 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 158
BstAFI CTTAAG 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 210
BstH2I RGCGCY 1 cut(s) 127
BstHHI GCGC 1 cut(s) 126
BstMAI GTCTC 3 cut(s) 155, 192, 202
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 158
BstNSI RCATGY 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 46
BveI ACCTGC 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 210
CciI TCATGA 1 cut(s) 190
CfoI GCGC 1 cut(s) 126
Csp6I GTAC 1 cut(s) 98
CspCI CAANNNNNGTGG 2 cut(s) 120, 155
CviAII CATG 2 cut(s) 191, 209
CviJI RGCY 2 cut(s) 46, 115
CviKI_1 RGCY 2 cut(s) 46, 115
CviQI GTAC 1 cut(s) 98
Eco31I GGTCTC 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 214
FaeI CATG 2 cut(s) 194, 212
FaiI YATR 4 cut(s) 137, 192, 210, 214
FatI CATG 2 cut(s) 190, 208
GlaI GCGC 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 104
HaeII RGCGCY 1 cut(s) 127
HaeIII GGCC 1 cut(s) 46
HhaI GCGC 1 cut(s) 126
Hin1II CATG 2 cut(s) 194, 212
Hin6I GCGC 1 cut(s) 124
HinP1I GCGC 1 cut(s) 124
HinfI GANTC 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 1 cut(s) 191
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 3 cut(s) 4, 208, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
Hsp92II CATG 2 cut(s) 194, 212
HspAI GCGC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 5 cut(s) 44, 134, 143, 170, 184
MluCI AATT 1 cut(s) 69
MnlI CCTC 3 cut(s) 48, 111, 128
Mph1103I ATGCAT 1 cut(s) 214
MseI TTAA 2 cut(s) 75, 150
MspCI CTTAAG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 2 cut(s) 194, 212
NsiI ATGCAT 1 cut(s) 214
NspI RCATGY 1 cut(s) 212
PaeI GCATGC 1 cut(s) 212
PagI TCATGA 1 cut(s) 190
PfeI GAWTC 1 cut(s) 179
PfoI TCCNGGA 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 2 cut(s) 75, 150
ScrFI CCNGG 1 cut(s) 158
SetI ASST 3 cut(s) 63, 103, 117
SgeI CNNG 9 cut(s) 39, 71, 133, 144, 169, 170, 183, 195, 203
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SphI GCATGC 1 cut(s) 212
Sse9I AATT 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 156
TasI AATT 1 cut(s) 69
TfiI GAWTC 1 cut(s) 179
Tru1I TTAA 2 cut(s) 75, 150
Tru9I TTAA 2 cut(s) 75, 150
Vha464I CTTAAG 1 cut(s) 74
XapI RAATTY 1 cut(s) 69
XceI RCATGY 1 cut(s) 212
Zsp2I ATGCAT 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.