Rh2AG323200

G-type lectin S-receptor-like serine threonine-protein kinase At2g19130

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
46482564 .. 46482983
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG323200.1

Sequence Viewer

Length: 246 bp
ATGCAAAGTAGTGTGTTGGTGTATTCAGGTGATGAGAAGGATAGGCCAACAATGAGGCAGGTTGTTCAAATTCTTGAGGGAGTTTTAGATGTTAGTGTATCCCCAATCCCACAGCTCCTCCAGCGCCTTACAGAAAGTATAGTGGAAGTGACTTCCAGGAGACCTACTTCCTGTTCAGATTTGTGGTCGCATGATGTCTCCAATGTGCATGCACAACAATCAGAAACCGGAGGTCCTGCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

81

Amino Acids

8.88

Weight (kDa)

4.85

Isoelectric Point (pI)

66.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019776)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 69
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw26I GTCTC 2 cut(s) 154, 202
AoxI GGCC 1 cut(s) 44
ApoI RAATTY 1 cut(s) 69
AspLEI GCGC 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 41
AvaII GGWCC 1 cut(s) 233
BciT130I CCWGG 1 cut(s) 157
BciVI GTATCC 1 cut(s) 109
BcoDI GTCTC 2 cut(s) 154, 202
BfoI RGCGCY 1 cut(s) 127
BfuAI ACCTGC 1 cut(s) 49
BfuI GTATCC 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 157
Bme18I GGWCC 1 cut(s) 233
BmgT120I GGNCC 1 cut(s) 233
BmrFI CCNGG 1 cut(s) 157
BpmI CTGGAG 1 cut(s) 104
BpuEI CTTGAG 1 cut(s) 95
BsaI GGTCTC 1 cut(s) 154
BsaWI WCCGGW 1 cut(s) 227
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
BseBI CCWGG 1 cut(s) 157
BseRI GAGGAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 46
BsiSI CCGG 1 cut(s) 228
BsmAI GTCTC 2 cut(s) 154, 202
BsnI GGCC 1 cut(s) 46
Bso31I GGTCTC 1 cut(s) 154
BspANI GGCC 1 cut(s) 46
BspMI ACCTGC 1 cut(s) 49
BspTNI GGTCTC 1 cut(s) 154
Bst2UI CCWGG 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 210
BstH2I RGCGCY 1 cut(s) 127
BstHHI GCGC 1 cut(s) 126
BstMAI GTCTC 2 cut(s) 154, 202
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 155
BsuI GTATCC 1 cut(s) 109
BsuRI GGCC 1 cut(s) 46
BveI ACCTGC 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 210
CfoI GCGC 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 233
CviAII CATG 2 cut(s) 191, 209
CviJI RGCY 2 cut(s) 46, 115
CviKI_1 RGCY 2 cut(s) 46, 115
Eco31I GGTCTC 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 233
EcoO109I RGGNCCY 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 155
FaeI CATG 2 cut(s) 194, 212
FaiI YATR 3 cut(s) 140, 192, 210
FatI CATG 2 cut(s) 190, 208
GlaI GCGC 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 104
HaeII RGCGCY 1 cut(s) 127
HaeIII GGCC 1 cut(s) 46
HapII CCGG 1 cut(s) 228
HhaI GCGC 1 cut(s) 126
Hin1II CATG 2 cut(s) 194, 212
Hin6I GCGC 1 cut(s) 124
HinP1I GCGC 1 cut(s) 124
HpaII CCGG 1 cut(s) 228
HphI GGTGA 1 cut(s) 41
Hpy188I TCNGA 2 cut(s) 178, 223
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 3 cut(s) 4, 208, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
Hsp92II CATG 2 cut(s) 194, 212
HspAI GCGC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 7 cut(s) 12, 44, 134, 142, 169, 184, 241
MaeIII GTNAC 1 cut(s) 148
MluCI AATT 1 cut(s) 69
MnlI CCTC 4 cut(s) 48, 70, 128, 224
MspI CCGG 1 cut(s) 228
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 2 cut(s) 194, 212
NmuCI GTSAC 1 cut(s) 148
NspI RCATGY 1 cut(s) 212
PaeI GCATGC 1 cut(s) 212
PfoI TCCNGGA 1 cut(s) 155
PpuMI RGGWCCY 1 cut(s) 233
Psp5II RGGWCCY 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PspPI GGNCC 1 cut(s) 233
PspPPI RGGWCCY 1 cut(s) 233
Sau96I GGNCC 1 cut(s) 233
ScrFI CCNGG 1 cut(s) 157
SetI ASST 5 cut(s) 31, 63, 117, 166, 235
SinI GGWCC 1 cut(s) 233
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SphI GCATGC 1 cut(s) 212
Sse9I AATT 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 155
TasI AATT 1 cut(s) 69
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 233
XapI RAATTY 1 cut(s) 69
XceI RCATGY 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.