Rroxscaffold_1G00002610

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0022436
Physical Location & Seq
Reverse (-)
3073338 .. 3078413
5076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00002610.1

Sequence Viewer

Length: 474 bp
ATGGCAACTGATCTACAGAACCTATTCCCTGTGACCAGCGACGGAAACAACACTGCGGTTCTTGATCGGAACTCTAGAGATTTATTCGACAACCATTACTTTCAGAACTTGCTCACCGGAAAGGGCCTTCTCAGTTCTGATCAGCTTTTAATTTCTAGTGATTTAGCCGATACAACAAGTACCAAGAGCTTGGTCCAAAGCTATAGCTCTAATTCCAACCTTTTCCTGGCAGATTTTGCTAATTCTATGATCAAAATGCTAAGTATAAGTCCACTGACCGGGTCTGCTGGAGAGATAAGAAAGAACTGCAGAGGCCTTGTTGCTAATACTGCGATGTATATGAGTGATGAGAAAGTTGTTGGTTTCAATGGGTTGGCTAAGCAAGCTCTTCAAGTTGTGCATAGGGTCAATGTGGGAGGTCATAAAGTGACGCCCTTTAATGATAGTCGTGAAGGACTTGGATTACCGATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
peroxidase

Protein Analysis

157

Amino Acids

16.96

Weight (kDa)

6.26

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 13 - 71 5.7e-08 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022436)

Species Orthologous Gene IDs
malus_domestica MD11G1015500.v1.1
rosa_chinensis RchiOBHm_Chr5g0080851
rosa_roxburghii Rroxscaffold_1G00002610
rosa_samantha Rh5CG570800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 56
AcyI GRCGYC 1 cut(s) 431
AfaI GTAC 1 cut(s) 181
AfiI CCNNNNNNNGG 2 cut(s) 226, 278
AgsI TTSAA 2 cut(s) 367, 392
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 5 cut(s) 145, 189, 201, 207, 386
AluI AGCT 5 cut(s) 145, 189, 201, 207, 386
AoxI GGCC 2 cut(s) 124, 313
Asp700I GAANNNNTTC 1 cut(s) 23
AspS9I GGNCC 2 cut(s) 124, 193
AsuC2I CCSGG 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 106
AvaII GGWCC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 227
BclI TGATCA 2 cut(s) 139, 249
BcnI CCSGG 1 cut(s) 280
BfaI CTAG 2 cut(s) 75, 156
BfmI CTRYAG 3 cut(s) 14, 202, 307
BlpI GCTNAGC 1 cut(s) 378
Bme1390I CCNGG 2 cut(s) 227, 280
Bme18I GGWCC 1 cut(s) 193
BmgT120I GGNCC 2 cut(s) 124, 193
BmrFI CCNGG 2 cut(s) 227, 280
BpmI CTGGAG 1 cut(s) 309
Bpu1102I GCTNAGC 1 cut(s) 378
BpuMI CCSGG 1 cut(s) 280
BsaHI GRCGYC 1 cut(s) 431
BsaWI WCCGGW 1 cut(s) 116
Bsc4I CCNNNNNNNGG 2 cut(s) 226, 278
BseBI CCWGG 1 cut(s) 227
BseLI CCNNNNNNNGG 2 cut(s) 226, 278
BseMII CTCAG 1 cut(s) 145
BshFI GGCC 2 cut(s) 126, 315
BsiSI CCGG 2 cut(s) 117, 279
BslI CCNNNNNNNGG 2 cut(s) 226, 278
BsnI GGCC 2 cut(s) 126, 315
Bsp143I GATC 4 cut(s) 10, 64, 139, 249
Bsp1720I GCTNAGC 1 cut(s) 378
BspACI CCGC 1 cut(s) 56
BspANI GGCC 2 cut(s) 126, 315
BspCNI CTCAG 1 cut(s) 144
BspMAI CTGCAG 1 cut(s) 311
BspQI GCTCTTC 1 cut(s) 393
BssMI GATC 4 cut(s) 10, 64, 139, 249
BssNI GRCGYC 1 cut(s) 431
Bst2UI CCWGG 1 cut(s) 227
Bst6I CTCTTC 1 cut(s) 393
BstACI GRCGYC 1 cut(s) 431
BstAPI GCANNNNNTGC 1 cut(s) 236
BstC8I GCNNGC 1 cut(s) 384
BstDEI CTNAG 3 cut(s) 131, 260, 378
BstKTI GATC 4 cut(s) 13, 67, 142, 252
BstMBI GATC 4 cut(s) 10, 64, 139, 249
BstMWI GCNNNNNNNGC 3 cut(s) 236, 329, 383
BstNI CCWGG 1 cut(s) 227
BstSCI CCNGG 2 cut(s) 225, 278
BstSFI CTRYAG 3 cut(s) 14, 202, 307
BstXI CCANNNNNNTGG 1 cut(s) 190
BsuRI GGCC 2 cut(s) 126, 315
BtgZI GCGATG 1 cut(s) 347
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 2 cut(s) 51, 272
Cac8I GCNNGC 1 cut(s) 384
Cfr13I GGNCC 2 cut(s) 124, 193
CseI GACGC 1 cut(s) 439
Csp6I GTAC 1 cut(s) 180
CviJI RGCY 9 cut(s) 126, 145, 167, 189, 201, 207, 315, 377, 386
CviKI_1 RGCY 9 cut(s) 126, 145, 167, 189, 201, 207, 315, 377, 386
CviQI GTAC 1 cut(s) 180
DdeI CTNAG 3 cut(s) 131, 260, 378
DpnI GATC 4 cut(s) 12, 66, 141, 251
DpnII GATC 4 cut(s) 10, 64, 139, 249
Eam1104I CTCTTC 1 cut(s) 393
EarI CTCTTC 1 cut(s) 393
Eco147I AGGCCT 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 193
EcoO109I RGGNCCY 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 225
FaiI YATR 7 cut(s) 204, 248, 266, 339, 341, 402, 423
FbaI TGATCA 2 cut(s) 139, 249
FspBI CTAG 2 cut(s) 75, 156
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 2 cut(s) 126, 315
HapII CCGG 2 cut(s) 117, 279
HgaI GACGC 1 cut(s) 439
Hin1I GRCGYC 1 cut(s) 431
HpaII CCGG 2 cut(s) 117, 279
HphI GGTGA 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 272
Hpy188I TCNGA 3 cut(s) 69, 105, 139
Hpy188III TCNNGA 3 cut(s) 62, 75, 449
Hpy8I GTNNAC 1 cut(s) 272
Hpy99I CGWCG 1 cut(s) 44
HpyAV CCTTC 2 cut(s) 137, 446
HpyCH4V TGCA 2 cut(s) 309, 400
HpyF10VI GCNNNNNNNGC 3 cut(s) 236, 329, 383
HpyF3I CTNAG 3 cut(s) 131, 260, 378
Hsp92I GRCGYC 1 cut(s) 431
Ksp22I TGATCA 2 cut(s) 139, 249
Kzo9I GATC 4 cut(s) 10, 64, 139, 249
LguI GCTCTTC 1 cut(s) 393
LpnPI CCDG 7 cut(s) 42, 49, 130, 212, 239, 273, 292
MaeI CTAG 2 cut(s) 75, 156
MaeIII GTNAC 2 cut(s) 31, 427
MalI GATC 4 cut(s) 12, 66, 141, 251
MboI GATC 4 cut(s) 10, 64, 139, 249
MboII GAAGA 1 cut(s) 380
MluCI AATT 3 cut(s) 150, 211, 241
MmeI TCCRAC 1 cut(s) 240
MnlI CCTC 2 cut(s) 305, 410
MroXI GAANNNNTTC 1 cut(s) 23
MseI TTAA 3 cut(s) 149, 438, 472
MspI CCGG 2 cut(s) 117, 279
MspR9I CCNGG 2 cut(s) 227, 280
MvaI CCWGG 1 cut(s) 227
MwoI GCNNNNNNNGC 3 cut(s) 236, 329, 383
NciI CCSGG 1 cut(s) 280
NdeII GATC 4 cut(s) 10, 64, 139, 249
NmuCI GTSAC 2 cut(s) 31, 427
PceI AGGCCT 1 cut(s) 315
PciSI GCTCTTC 1 cut(s) 393
PdmI GAANNNNTTC 1 cut(s) 23
PflFI GACNNNGTC 1 cut(s) 280
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspPI GGNCC 2 cut(s) 124, 193
PstI CTGCAG 1 cut(s) 311
PsyI GACNNNGTC 1 cut(s) 280
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
SapI GCTCTTC 1 cut(s) 393
SaqAI TTAA 3 cut(s) 149, 438, 472
Sau3AI GATC 4 cut(s) 10, 64, 139, 249
Sau96I GGNCC 2 cut(s) 124, 193
ScrFI CCNGG 2 cut(s) 227, 280
SetI ASST 8 cut(s) 24, 147, 191, 203, 209, 222, 388, 421
SfcI CTRYAG 3 cut(s) 14, 202, 307
SinI GGWCC 1 cut(s) 193
Sse9I AATT 3 cut(s) 150, 211, 241
SseBI AGGCCT 1 cut(s) 315
SsiI CCGC 1 cut(s) 56
SspMI CTAG 2 cut(s) 75, 156
StuI AGGCCT 1 cut(s) 315
StyD4I CCNGG 2 cut(s) 225, 278
TaqI TCGA 1 cut(s) 87
TasI AATT 3 cut(s) 150, 211, 241
Tru1I TTAA 3 cut(s) 149, 438, 472
Tru9I TTAA 3 cut(s) 149, 438, 472
TscAI CASTG 2 cut(s) 58, 279
TseFI GTSAC 2 cut(s) 31, 427
Tsp45I GTSAC 2 cut(s) 31, 427
TspGWI ACGGA 1 cut(s) 57
TspRI CASTG 2 cut(s) 58, 279
Tth111I GACNNNGTC 1 cut(s) 280
VpaK11BI GGWCC 1 cut(s) 193
XbaI TCTAGA 1 cut(s) 74
XcmI CCANNNNNNNNNTGG 1 cut(s) 223
XmnI GAANNNNTTC 1 cut(s) 23
XspI CTAG 2 cut(s) 75, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.