Rroxscaffold_1G00003390

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
4125269 .. 4127290
2022 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00003390.1

Sequence Viewer

Length: 336 bp
ATGCACTGTGAGTCTGCAACTTTCTTCGATTCTCCTAAACTCTACTCCATTTTCTCTTCTTCAATCTCCACCATGAAACCCAGAACGCAAAGACTCTTGCTTTCCTTCTTCGCCCTCATTCTCATGCTCCACATTTCCCAAAGCTCTCAACTTTCAGACTCACAAACCCATCTGATCAGACCCAGAAACCAACCCAGAAGATTGCTCCCTTCAGTAGCCACATTTTCTTCGAACCAAAATAAGCCCAACAAAGCAATGGAGGATCCCCACAAACCCATAGAGACTAGCTTGAAGAAGGCTCCACCCAGCAAATCGAATCCGACCCACAATCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.6

Weight (kDa)

10.5

Isoelectric Point (pI)

74.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 257, 270
AcuI CTGAAG 1 cut(s) 195
AfiI CCNNNNNNNGG 1 cut(s) 330
AgsI TTSAA 2 cut(s) 63, 292
AluBI AGCT 2 cut(s) 144, 288
AluI AGCT 2 cut(s) 144, 288
Alw26I GTCTC 1 cut(s) 275
AlwI GGATC 2 cut(s) 257, 270
AsuII TTCGAA 1 cut(s) 230
BamHI GGATCC 1 cut(s) 262
BccI CCATC 1 cut(s) 177
BclI TGATCA 1 cut(s) 174
BcoDI GTCTC 1 cut(s) 275
BfaI CTAG 1 cut(s) 285
BmiI GGNNCC 2 cut(s) 264, 300
Bpu14I TTCGAA 1 cut(s) 230
Bsc4I CCNNNNNNNGG 1 cut(s) 330
Bse3DI GCAATG 1 cut(s) 261
BseLI CCNNNNNNNGG 1 cut(s) 330
BseMI GCAATG 1 cut(s) 261
BseYI CCCAGC 1 cut(s) 305
BslI CCNNNNNNNGG 1 cut(s) 330
BsmAI GTCTC 1 cut(s) 275
Bsp119I TTCGAA 1 cut(s) 230
Bsp143I GATC 2 cut(s) 174, 262
BspLI GGNNCC 2 cut(s) 264, 300
BspPI GGATC 2 cut(s) 257, 270
BspT104I TTCGAA 1 cut(s) 230
BsrDI GCAATG 1 cut(s) 261
BssMI GATC 2 cut(s) 174, 262
Bst4CI ACNGT 1 cut(s) 8
Bst6I CTCTTC 1 cut(s) 61
BstBI TTCGAA 1 cut(s) 230
BstKTI GATC 2 cut(s) 177, 265
BstMAI GTCTC 1 cut(s) 275
BstMBI GATC 2 cut(s) 174, 262
BstX2I RGATCY 1 cut(s) 262
BstYI RGATCY 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 4
CviAII CATG 2 cut(s) 73, 124
CviJI RGCY 5 cut(s) 144, 218, 244, 288, 299
CviKI_1 RGCY 5 cut(s) 144, 218, 244, 288, 299
DpnI GATC 2 cut(s) 176, 264
DpnII GATC 2 cut(s) 174, 262
Eam1104I CTCTTC 1 cut(s) 61
EarI CTCTTC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 195
FaeI CATG 2 cut(s) 76, 127
FaiI YATR 3 cut(s) 74, 125, 278
FatI CATG 2 cut(s) 72, 123
FbaI TGATCA 1 cut(s) 174
FspBI CTAG 1 cut(s) 285
GsaI CCCAGC 1 cut(s) 309
Hin1II CATG 2 cut(s) 76, 127
HinfI GANTC 5 cut(s) 11, 29, 93, 158, 316
Hpy188I TCNGA 4 cut(s) 157, 174, 179, 321
HpyAV CCTTC 3 cut(s) 115, 219, 289
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 4, 17
Hsp92II CATG 2 cut(s) 76, 127
Ksp22I TGATCA 1 cut(s) 174
Kzo9I GATC 2 cut(s) 174, 262
LmnI GCTCC 3 cut(s) 132, 210, 304
LpnPI CCDG 4 cut(s) 94, 196, 208, 319
MaeI CTAG 1 cut(s) 285
MalI GATC 2 cut(s) 176, 264
MboI GATC 2 cut(s) 174, 262
MboII GAAGA 7 cut(s) 16, 48, 51, 100, 210, 219, 304
MflI RGATCY 1 cut(s) 262
MlyI GAGTC 3 cut(s) 20, 87, 152
MnlI CCTC 2 cut(s) 125, 253
MslI CAYNNNNRTG 1 cut(s) 122
NdeII GATC 2 cut(s) 174, 262
NlaIII CATG 2 cut(s) 76, 127
NlaIV GGNNCC 2 cut(s) 264, 300
NspV TTCGAA 1 cut(s) 230
PfeI GAWTC 2 cut(s) 29, 316
PleI GAGTC 3 cut(s) 19, 87, 152
PpsI GAGTC 3 cut(s) 19, 87, 152
PspFI CCCAGC 1 cut(s) 305
PspN4I GGNNCC 2 cut(s) 264, 300
PsuI RGATCY 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 122
Sau3AI GATC 2 cut(s) 174, 262
SchI GAGTC 3 cut(s) 20, 87, 152
SetI ASST 2 cut(s) 146, 290
SfuI TTCGAA 1 cut(s) 230
SgeI CNNG 9 cut(s) 85, 93, 109, 136, 195, 207, 297, 301, 318
SmiMI CAYNNNNRTG 1 cut(s) 122
SspMI CTAG 1 cut(s) 285
TaaI ACNGT 1 cut(s) 8
TaqI TCGA 3 cut(s) 27, 230, 314
TfiI GAWTC 2 cut(s) 29, 316
TspDTI ATGAA 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 253
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.