Rh7DG470800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0016367
Physical Location & Seq
Reverse (-)
67262977 .. 67264043
1067 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG470800.1

Sequence Viewer

Length: 273 bp
ATGGAGGATCCCCACAAACCCATAGAGACCAGCTTGAAGAAAGCTCGACCCAGCGCAACAAATCGAATCAGACCCACAACGTTGGAGGAGGAGTCGTCGGCGGCGACGGTGGCGATTCTGGCGGCAGAGATGAAGCGGCGCTCGTCGAGGCCGGCGCTCCAGCCGACCAGAAAATCGGAGATTATTCTCGTCGAGGCTGTCTCTCCAGCCGCCCCAGATCGGAGATCTTTCTCGTTGAGGCCGGCGCTCAGAAACTTGCCGCCTTGTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.97

Weight (kDa)

10.8

Isoelectric Point (pI)

103.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 101, 122, 136, 210, 260
AclI AACGTT 1 cut(s) 80
AclWI GGATC 2 cut(s) 2, 15
AfiI CCNNNNNNNGG 1 cut(s) 219
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 2 cut(s) 33, 44
AluI AGCT 2 cut(s) 33, 44
Alw26I GTCTC 2 cut(s) 20, 205
AlwI GGATC 2 cut(s) 2, 15
AoxI GGCC 2 cut(s) 149, 239
AspLEI GCGC 4 cut(s) 56, 141, 157, 247
BamHI GGATCC 1 cut(s) 7
BcoDI GTCTC 2 cut(s) 20, 205
BfoI RGCGCY 3 cut(s) 142, 158, 248
BglII AGATCT 1 cut(s) 224
BisI GCNGC 5 cut(s) 102, 123, 137, 210, 260
BlsI GCNGC 5 cut(s) 103, 124, 138, 211, 261
BmiI GGNNCC 1 cut(s) 9
BplI GAGNNNNNCTC 2 cut(s) 185, 217
BpmI CTGGAG 2 cut(s) 143, 189
BsaI GGTCTC 1 cut(s) 20
BsaXI ACNNNNNCTCC 4 cut(s) 77, 80, 107, 110
Bsc4I CCNNNNNNNGG 1 cut(s) 219
Bse118I RCCGGY 2 cut(s) 151, 241
BseLI CCNNNNNNNGG 1 cut(s) 219
BseMII CTCAG 1 cut(s) 262
BseRI GAGGAG 2 cut(s) 101, 104
BseYI CCCAGC 1 cut(s) 50
BshFI GGCC 2 cut(s) 151, 241
BsiSI CCGG 2 cut(s) 152, 242
BslI CCNNNNNNNGG 1 cut(s) 219
BsmAI GTCTC 2 cut(s) 20, 205
BsnI GGCC 2 cut(s) 151, 241
Bso31I GGTCTC 1 cut(s) 20
Bsp143I GATC 3 cut(s) 7, 217, 224
BspACI CCGC 5 cut(s) 101, 122, 136, 210, 260
BspANI GGCC 2 cut(s) 151, 241
BspCNI CTCAG 1 cut(s) 261
BspLI GGNNCC 1 cut(s) 9
BspPI GGATC 2 cut(s) 2, 15
BspTNI GGTCTC 1 cut(s) 20
BsrFI RCCGGY 2 cut(s) 151, 241
BssAI RCCGGY 2 cut(s) 151, 241
BssMI GATC 3 cut(s) 7, 217, 224
Bst4CI ACNGT 1 cut(s) 109
BstC8I GCNNGC 2 cut(s) 153, 243
BstDEI CTNAG 1 cut(s) 248
BstH2I RGCGCY 3 cut(s) 142, 158, 248
BstHHI GCGC 4 cut(s) 56, 141, 157, 247
BstKTI GATC 3 cut(s) 10, 220, 227
BstMAI GTCTC 2 cut(s) 20, 205
BstMBI GATC 3 cut(s) 7, 217, 224
BstMWI GCNNNNNNNGC 2 cut(s) 110, 119
BstX2I RGATCY 2 cut(s) 7, 224
BstXI CCANNNNNNTGG 1 cut(s) 82
BstYI RGATCY 2 cut(s) 7, 224
BsuRI GGCC 2 cut(s) 151, 241
Cac8I GCNNGC 2 cut(s) 153, 243
CfoI GCGC 4 cut(s) 56, 141, 157, 247
Cfr10I RCCGGY 2 cut(s) 151, 241
CviJI RGCY 7 cut(s) 33, 44, 151, 163, 197, 209, 241
CviKI_1 RGCY 7 cut(s) 33, 44, 151, 163, 197, 209, 241
DdeI CTNAG 1 cut(s) 248
DpnI GATC 3 cut(s) 9, 219, 226
DpnII GATC 3 cut(s) 7, 217, 224
Eco31I GGTCTC 1 cut(s) 20
FaiI YATR 1 cut(s) 23
Fnu4HI GCNGC 5 cut(s) 102, 123, 137, 210, 260
Fsp4HI GCNGC 5 cut(s) 102, 123, 137, 210, 260
GlaI GCGC 4 cut(s) 55, 140, 156, 246
GluI GCNGC 5 cut(s) 102, 123, 137, 210, 260
GsaI CCCAGC 1 cut(s) 54
GsuI CTGGAG 2 cut(s) 143, 189
HaeII RGCGCY 3 cut(s) 142, 158, 248
HaeIII GGCC 2 cut(s) 151, 241
HapII CCGG 2 cut(s) 152, 242
HhaI GCGC 4 cut(s) 56, 141, 157, 247
Hin6I GCGC 4 cut(s) 54, 139, 155, 245
HinP1I GCGC 4 cut(s) 54, 139, 155, 245
HinfI GANTC 3 cut(s) 66, 92, 115
HpaII CCGG 2 cut(s) 152, 242
Hpy188I TCNGA 4 cut(s) 71, 178, 222, 251
Hpy99I CGWCG 4 cut(s) 100, 109, 148, 194
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 2 cut(s) 110, 119
HpyF3I CTNAG 1 cut(s) 248
HpySE526I ACGT 1 cut(s) 80
HspAI GCGC 4 cut(s) 54, 139, 155, 245
KroI GCCGGC 2 cut(s) 151, 241
KroNI GCCGGC 2 cut(s) 153, 243
Kzo9I GATC 3 cut(s) 7, 217, 224
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 9 cut(s) 43, 64, 104, 165, 173, 181, 219, 228, 255
MaeII ACGT 1 cut(s) 80
MalI GATC 3 cut(s) 9, 219, 226
MboI GATC 3 cut(s) 7, 217, 224
MboII GAAGA 1 cut(s) 49
MflI RGATCY 2 cut(s) 7, 224
MlyI GAGTC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 5 cut(s) 79, 82, 141, 187, 231
MroNI GCCGGC 2 cut(s) 151, 241
MspI CCGG 2 cut(s) 152, 242
MwoI GCNNNNNNNGC 2 cut(s) 110, 119
NaeI GCCGGC 2 cut(s) 153, 243
NdeII GATC 3 cut(s) 7, 217, 224
NgoMIV GCCGGC 2 cut(s) 151, 241
NlaIV GGNNCC 1 cut(s) 9
PcsI WCGNNNNNNNCGW 1 cut(s) 101
PdiI GCCGGC 2 cut(s) 153, 243
PfeI GAWTC 2 cut(s) 66, 115
PkrI GCNGC 5 cut(s) 103, 124, 138, 211, 261
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
Psp1406I AACGTT 1 cut(s) 80
PspFI CCCAGC 1 cut(s) 50
PspN4I GGNNCC 1 cut(s) 9
PsuI RGATCY 2 cut(s) 7, 224
SatI GCNGC 5 cut(s) 102, 123, 137, 210, 260
Sau3AI GATC 3 cut(s) 7, 217, 224
SchI GAGTC 1 cut(s) 101
SetI ASST 3 cut(s) 35, 46, 83
SsiI CCGC 5 cut(s) 101, 122, 136, 210, 260
TaaI ACNGT 1 cut(s) 109
TaiI ACGT 1 cut(s) 83
TaqI TCGA 4 cut(s) 46, 64, 146, 192
TauI GCSGC 5 cut(s) 104, 125, 139, 212, 262
TfiI GAWTC 2 cut(s) 66, 115
TspDTI ATGAA 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.