Rroxscaffold_1G00043930

Endoplasmin homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
62682181 .. 62684868
2688 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00043930.1

Sequence Viewer

Length: 180 bp
ATGTCCATACGTGATTGGGGTATAGGTATGACAAAGGAGGACTTGATCAAGAACTTGGAAACTATAGCAAAATCTGGAACTTCAGGTGCCACAGGCCTCTACAAAACCTCGAAAAAAAAAACAACTTTCAGTGTGGCAAATGCGTCTCCAGTGATGGGTTCAAAGTGCAAGAGCAAGTAG

Protein Analysis

59

Amino Acids

6.28

Weight (kDa)

9.94

Isoelectric Point (pI)

23.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 66
AfiI CCNNNNNNNGG 1 cut(s) 155
AgsI TTSAA 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 150
AoxI GGCC 1 cut(s) 94
BanI GGYRCC 1 cut(s) 86
BccI CCATC 1 cut(s) 148
BclI TGATCA 1 cut(s) 45
BcoDI GTCTC 1 cut(s) 150
BfmI CTRYAG 1 cut(s) 63
BmiI GGNNCC 1 cut(s) 88
BpmI CTGGAG 1 cut(s) 132
BsaAI YACGTR 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 149
BseLI CCNNNNNNNGG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 149
BshFI GGCC 1 cut(s) 96
BshNI GGYRCC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 155
BsmAI GTCTC 1 cut(s) 150
BsmBI CGTCTC 1 cut(s) 150
BsnI GGCC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 45
BspANI GGCC 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 88
BspT107I GGYRCC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 149
BssMI GATC 1 cut(s) 45
BstBAI YACGTR 1 cut(s) 11
BstKTI GATC 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 1 cut(s) 45
BstSFI CTRYAG 1 cut(s) 63
BsuRI GGCC 1 cut(s) 96
BtsIMutI CAGTG 2 cut(s) 136, 156
CseI GACGC 1 cut(s) 132
CviJI RGCY 1 cut(s) 96
CviKI_1 RGCY 1 cut(s) 96
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eco147I AGGCCT 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 66
Esp3I CGTCTC 1 cut(s) 150
FaiI YATR 4 cut(s) 8, 23, 29, 65
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FbaI TGATCA 1 cut(s) 45
GsuI CTGGAG 1 cut(s) 132
HaeIII GGCC 1 cut(s) 96
HgaI GACGC 1 cut(s) 132
Hpy188III TCNNGA 2 cut(s) 49, 75
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 168
HpySE526I ACGT 1 cut(s) 10
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 1 cut(s) 45
LpnPI CCDG 4 cut(s) 60, 69, 78, 162
MaeII ACGT 1 cut(s) 10
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MnlI CCTC 3 cut(s) 31, 107, 118
NdeII GATC 1 cut(s) 45
NlaIV GGNNCC 1 cut(s) 88
PceI AGGCCT 1 cut(s) 96
Ppu21I YACGTR 1 cut(s) 11
PspN4I GGNNCC 1 cut(s) 88
Sau3AI GATC 1 cut(s) 45
SetI ASST 4 cut(s) 13, 28, 88, 110
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 9 cut(s) 23, 55, 61, 67, 87, 96, 105, 121, 161
SseBI AGGCCT 1 cut(s) 96
StuI AGGCCT 1 cut(s) 96
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 110
TscAI CASTG 2 cut(s) 136, 156
TspRI CASTG 2 cut(s) 136, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.