Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0018861

Physical Location & Seq

Genomic Coordinates Reverse (-)

84485992 .. 84488742

Gene Structure 2751 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00062430.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 747 bp

ATGGTGCATTCATACAGCAAAATGGTTTCACACAGGAAATCGGTGGTCTTCAATCACAAGCCAATACAGTTCGATCAGAATAATTACCCTCAGTTTCCAAACAACAACAATTCAAGGAATAGAGGCAACAATAATAGAAACACCAACTCAGGGAGCTACTCCAAACCAAGGTTTAACTCAAATCAACATCCGCTGATATGCCAAATTTGTGAGAAGCCTAGACATAGTGCTTATAAATGCTTTCAGAGAAACCCACAGCAACAAGGTGACGCCTCTAGCTCTACTATTGAATGTCATATTTGCAAGAAATCAGGCCATACTACAAAAACTTGCAGGTATAGAGTCAATAACAATAATTCAAGGAATGGAGGCAACAACAATAGAAACACCAACTCAAGGAGCTACTCCAAACCAAGTTTTAACTCAAAGCAAGGTCCACTGATATGCCAAATTTGTGAGAAGCTTGGACATAGTGCTTATAAATGCTTTCAGAGAAACCCACAGCAACAAGATGAAGCCTCTAGCTCTACTGTTGAATGTCATATTTGCAAGAAATCAGGCCATACTACAAAAACTTGCAGGTACAGAGTCAATAATCAAAATGGGAATACTGCAATGGTTGCCTGCACTGATAATGCATTTGTTCATGAAGTTTGGCTAGTTGGCATGCAGAAGCAACGTGATGAATGTGCACCAGCTATTTTTGAAAGAAGAATCACTGATAATGATGATAAAATGAGTCAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

248

Amino Acids

28.42

Weight (kDa)

9.62

Isoelectric Point (pI)

46.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018861)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g13581
rosa_chinensis	RchiOBHm_Chr1g0366991 RchiOBHm_Chr2g0088091 RchiOBHm_Chr3g0448951
rosa_roxburghii	Rroxscaffold_1G00056070 Rroxscaffold_1G00062430 Rroxscaffold_4G00299660
rosa_samantha	Rh5AG038900 Rh5CG042000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	234, 480
Acc36I	ACCTGC	2 cut(s)	324, 570
AciI	CCGC	1 cut(s)	191
AcsI	RAATTY	2 cut(s)	204, 450
AcyI	GRCGYC	1 cut(s)	270
AfaI	GTAC	1 cut(s)	584
AfiI	CCNNNNNNNGG	3 cut(s)	150, 168, 396
AgsI	TTSAA	6 cut(s)	52, 114, 290, 360, 536, 707
AluBI	AGCT	6 cut(s)	156, 279, 402, 463, 525, 698
AluI	AGCT	6 cut(s)	156, 279, 402, 463, 525, 698
Alw21I	GWGCWC	1 cut(s)	694
Alw44I	GTGCAC	1 cut(s)	690
AoxI	GGCC	2 cut(s)	313, 559
ApaLI	GTGCAC	1 cut(s)	690
ApoI	RAATTY	2 cut(s)	204, 450
AspS9I	GGNCC	1 cut(s)	434
AsuHPI	GGTGA	1 cut(s)	278
AvaII	GGWCC	1 cut(s)	434
BaeGI	GKGCMC	1 cut(s)	694
BbsI	GAAGAC	1 cut(s)	40
Bbv12I	GWGCWC	1 cut(s)	694
BfaI	CTAG	4 cut(s)	219, 276, 522, 659
BfuAI	ACCTGC	2 cut(s)	324, 570
Bme18I	GGWCC	1 cut(s)	434
BmgT120I	GGNCC	1 cut(s)	434
BpiI	GAAGAC	1 cut(s)	40
BpuEI	CTTGAG	1 cut(s)	379
BsaHI	GRCGYC	1 cut(s)	270
BsaJI	CCNNGG	1 cut(s)	167
Bsc4I	CCNNNNNNNGG	3 cut(s)	150, 168, 396
Bse3DI	GCAATG	1 cut(s)	621
BseDI	CCNNGG	1 cut(s)	167
BseGI	GGATG	1 cut(s)	187
BseLI	CCNNNNNNNGG	3 cut(s)	150, 168, 396
BseMI	GCAATG	1 cut(s)	621
BseMII	CTCAG	2 cut(s)	104, 162
BseSI	GKGCMC	1 cut(s)	694
BsgI	GTGCAG	1 cut(s)	610
BshFI	GGCC	2 cut(s)	315, 561
BsiHKAI	GWGCWC	1 cut(s)	694
BslI	CCNNNNNNNGG	3 cut(s)	150, 168, 396
BsmI	GAATGC	1 cut(s)	7
BsnI	GGCC	2 cut(s)	315, 561
Bsp1286I	GDGCHC	1 cut(s)	694
Bsp143I	GATC	1 cut(s)	73
BspACI	CCGC	1 cut(s)	191
BspANI	GGCC	2 cut(s)	315, 561
BspCNI	CTCAG	2 cut(s)	103, 161
BspHI	TCATGA	1 cut(s)	646
BspMI	ACCTGC	2 cut(s)	324, 570
BsrDI	GCAATG	1 cut(s)	621
BssECI	CCNNGG	1 cut(s)	167
BssMI	GATC	1 cut(s)	73
BssNI	GRCGYC	1 cut(s)	270
BssT1I	CCWWGG	1 cut(s)	167
Bst4CI	ACNGT	2 cut(s)	69, 532
BstACI	GRCGYC	1 cut(s)	270
BstAPI	GCANNNNNTGC	1 cut(s)	620
BstC8I	GCNNGC	2 cut(s)	625, 668
BstDEI	CTNAG	2 cut(s)	90, 148
BstF5I	GGATG	1 cut(s)	187
BstKTI	GATC	1 cut(s)	76
BstMBI	GATC	1 cut(s)	73
BstMWI	GCNNNNNNNGC	1 cut(s)	620
BstNSI	RCATGY	1 cut(s)	670
BstSLI	GKGCMC	1 cut(s)	694
BstV2I	GAAGAC	1 cut(s)	40
BsuRI	GGCC	2 cut(s)	315, 561
BtsCI	GGATG	1 cut(s)	187
BtsIMutI	CAGTG	3 cut(s)	437, 627, 717
BveI	ACCTGC	2 cut(s)	324, 570
Cac8I	GCNNGC	2 cut(s)	625, 668
CciI	TCATGA	1 cut(s)	646
Cfr13I	GGNCC	1 cut(s)	434
CseI	GACGC	1 cut(s)	278
Csp6I	GTAC	1 cut(s)	583
CviAII	CATG	2 cut(s)	647, 667
CviQI	GTAC	1 cut(s)	583
DdeI	CTNAG	2 cut(s)	90, 148
DpnI	GATC	1 cut(s)	75
DpnII	GATC	1 cut(s)	73
Eco130I	CCWWGG	1 cut(s)	167
Eco47I	GGWCC	1 cut(s)	434
EcoT14I	CCWWGG	1 cut(s)	167
EcoT22I	ATGCAT	1 cut(s)	640
ErhI	CCWWGG	1 cut(s)	167
FaeI	CATG	2 cut(s)	650, 670
FatI	CATG	2 cut(s)	646, 666
FokI	GGATG	1 cut(s)	174
FspBI	CTAG	4 cut(s)	219, 276, 522, 659
HaeIII	GGCC	2 cut(s)	315, 561
HgaI	GACGC	1 cut(s)	278
Hin1I	GRCGYC	1 cut(s)	270
Hin1II	CATG	2 cut(s)	650, 670
HindIII	AAGCTT	1 cut(s)	461
HinfI	GANTC	4 cut(s)	342, 588, 714, 739
HphI	GGTGA	1 cut(s)	278
Hpy166II	GTNNAC	2 cut(s)	437, 692
Hpy188I	TCNGA	3 cut(s)	78, 246, 492
Hpy188III	TCNNGA	1 cut(s)	647
Hpy8I	GTNNAC	2 cut(s)	437, 692
HpyCH4III	ACNGT	2 cut(s)	69, 532
HpyCH4IV	ACGT	1 cut(s)	679
HpyF10VI	GCNNNNNNNGC	1 cut(s)	620
HpyF3I	CTNAG	2 cut(s)	90, 148
HpySE526I	ACGT	1 cut(s)	679
Hsp92I	GRCGYC	1 cut(s)	270
Hsp92II	CATG	2 cut(s)	650, 670
Kzo9I	GATC	1 cut(s)	73
LmnI	GCTCC	2 cut(s)	153, 399
LpnPI	CCDG	8 cut(s)	19, 135, 297, 319, 543, 565, 637, 708
MaeI	CTAG	4 cut(s)	219, 276, 522, 659
MaeII	ACGT	1 cut(s)	679
MaeIII	GTNAC	1 cut(s)	266
MalI	GATC	1 cut(s)	75
MboI	GATC	1 cut(s)	73
MboII	GAAGA	2 cut(s)	40, 723
MhlI	GDGCHC	1 cut(s)	694
MluCI	AATT	5 cut(s)	82, 109, 204, 355, 450
MlyI	GAGTC	2 cut(s)	351, 597
MnlI	CCTC	5 cut(s)	99, 116, 283, 362, 529
Mph1103I	ATGCAT	1 cut(s)	640
MseI	TTAA	2 cut(s)	174, 420
MslI	CAYNNNNRTG	1 cut(s)	442
MspA1I	CMGCKG	1 cut(s)	193
Mva1269I	GAATGC	1 cut(s)	7
MwoI	GCNNNNNNNGC	1 cut(s)	620
NdeII	GATC	1 cut(s)	73
NlaIII	CATG	2 cut(s)	650, 670
NmuCI	GTSAC	1 cut(s)	266
NsiI	ATGCAT	1 cut(s)	640
NspI	RCATGY	1 cut(s)	670
PaeI	GCATGC	1 cut(s)	670
PagI	TCATGA	1 cut(s)	646
PctI	GAATGC	1 cut(s)	7
PfeI	GAWTC	1 cut(s)	714
PleI	GAGTC	2 cut(s)	350, 596
PpsI	GAGTC	2 cut(s)	350, 596
PsiI	TTATAA	2 cut(s)	234, 480
PspPI	GGNCC	1 cut(s)	434
RsaI	GTAC	1 cut(s)	584
RsaNI	GTAC	1 cut(s)	583
RseI	CAYNNNNRTG	1 cut(s)	442
SaqAI	TTAA	2 cut(s)	174, 420
Sau3AI	GATC	1 cut(s)	73
Sau96I	GGNCC	1 cut(s)	434
SchI	GAGTC	2 cut(s)	351, 597
SduI	GDGCHC	1 cut(s)	694
SinI	GGWCC	1 cut(s)	434
SmiMI	CAYNNNNRTG	1 cut(s)	442
SmlI	CTYRAG	1 cut(s)	394
SmoI	CTYRAG	1 cut(s)	394
SphI	GCATGC	1 cut(s)	670
Sse9I	AATT	5 cut(s)	82, 109, 204, 355, 450
SsiI	CCGC	1 cut(s)	191
SspMI	CTAG	4 cut(s)	219, 276, 522, 659
StyI	CCWWGG	1 cut(s)	167
TaaI	ACNGT	2 cut(s)	69, 532
TaiI	ACGT	1 cut(s)	682
TaqI	TCGA	1 cut(s)	72
TasI	AATT	5 cut(s)	82, 109, 204, 355, 450
TfiI	GAWTC	1 cut(s)	714
Tru1I	TTAA	2 cut(s)	174, 420
Tru9I	TTAA	2 cut(s)	174, 420
TscAI	CASTG	3 cut(s)	444, 634, 724
TseFI	GTSAC	1 cut(s)	266
Tsp45I	GTSAC	1 cut(s)	266
TspDTI	ATGAA	4 cut(s)	528, 635, 663, 699
TspRI	CASTG	3 cut(s)	444, 634, 724
VneI	GTGCAC	1 cut(s)	690
VpaK11BI	GGWCC	1 cut(s)	434
XapI	RAATTY	2 cut(s)	204, 450
XceI	RCATGY	1 cut(s)	670
XspI	CTAG	4 cut(s)	219, 276, 522, 659
Zsp2I	ATGCAT	1 cut(s)	640

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.