Rroxscaffold_2G00077060

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
735494 .. 735820
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00077060.1

Sequence Viewer

Length: 186 bp
ATGGAGATGGAAAGCTTGAACGTTGGAATCTTGAATCTTGGAAGCAAGTCTTCAAGGTGGATGATGGAGGCTAGGATCTTCACGGCTTCTTCTTCTTATTCTTCCTCTCCTTGCTTGAAGACGCATAACTTGAAACTAGAGAGTGGAGAGGGAGGGAGAGCTTATGATGGAGATTTTTCTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.69

Weight (kDa)

5.25

Isoelectric Point (pI)

63.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019022)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 21
AclWI GGATC 1 cut(s) 83
AgsI TTSAA 5 cut(s) 19, 34, 54, 118, 133
AluBI AGCT 2 cut(s) 15, 161
AluI AGCT 2 cut(s) 15, 161
AlwI GGATC 1 cut(s) 83
BbsI GAAGAC 2 cut(s) 42, 125
BccI CCATC 2 cut(s) 58, 161
BceAI ACGGC 1 cut(s) 99
BfaI CTAG 2 cut(s) 72, 137
BpiI GAAGAC 2 cut(s) 42, 125
BseGI GGATG 1 cut(s) 66
Bsp143I GATC 1 cut(s) 75
BspPI GGATC 1 cut(s) 83
BssMI GATC 1 cut(s) 75
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstV2I GAAGAC 2 cut(s) 42, 125
BstX2I RGATCY 1 cut(s) 75
BstYI RGATCY 1 cut(s) 75
BtsCI GGATG 1 cut(s) 66
CseI GACGC 1 cut(s) 130
CviJI RGCY 4 cut(s) 15, 71, 86, 161
CviKI_1 RGCY 4 cut(s) 15, 71, 86, 161
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
FaiI YATR 2 cut(s) 126, 165
FalI AAGNNNNNCTT 2 cut(s) 34, 66
FokI GGATG 1 cut(s) 73
FspBI CTAG 2 cut(s) 72, 137
HgaI GACGC 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 13
HinfI GANTC 2 cut(s) 27, 34
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 21
HpySE526I ACGT 1 cut(s) 21
Kzo9I GATC 1 cut(s) 75
MaeI CTAG 2 cut(s) 72, 137
MaeII ACGT 1 cut(s) 21
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 6 cut(s) 42, 70, 81, 84, 93, 130
MflI RGATCY 1 cut(s) 75
MmeI TCCRAC 1 cut(s) 4
MnlI CCTC 4 cut(s) 61, 115, 142, 146
NdeII GATC 1 cut(s) 75
PfeI GAWTC 2 cut(s) 27, 34
Psp1406I AACGTT 1 cut(s) 21
PsuI RGATCY 1 cut(s) 75
Sau3AI GATC 1 cut(s) 75
SetI ASST 4 cut(s) 17, 24, 59, 163
SspMI CTAG 2 cut(s) 72, 137
TaiI ACGT 1 cut(s) 24
TfiI GAWTC 2 cut(s) 27, 34
XspI CTAG 2 cut(s) 72, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.