Rroxscaffold_2G00126150
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
61204746 .. 61205862
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00126150.1

Sequence Viewer

Length: 195 bp
ATGTCGTGCTTGTCTTCATATGGATCAGAGGAGGACGATAAAAGTATTGACTCTTACAGAAAAGGAGAGTACCACGCTGGAATTTTGAGAAGGAGAAGAAATCAGAAGAGGACCTCTAGCTTCCAAGAAGTTGATGATGTTGTTCTCATAGTCCTTCACCTTCACCTTCACCTTCTTTCCAAGACGATCGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.43

Weight (kDa)

7.95

Isoelectric Point (pI)

74.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022931)

Species Orthologous Gene IDs
rosa_laevigata RLG00000021785
rosa_roxburghii Rroxscaffold_2G00126150
rosa_samantha Rh1BG241900 Rh6AG058700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 81
AfaI GTAC 1 cut(s) 71
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
AlwI GGATC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 111
AsuHPI GGTGA 3 cut(s) 149, 155, 161
AvaII GGWCC 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 6
BfaI CTAG 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 111
BmgT120I GGNCC 1 cut(s) 111
BpiI GAAGAC 1 cut(s) 6
BseRI GAGGAG 1 cut(s) 44
Bsh1285I CGRYCG 1 cut(s) 189
BsiEI CGRYCG 1 cut(s) 189
Bsp143I GATC 2 cut(s) 23, 186
BspPI GGATC 1 cut(s) 31
BssMI GATC 2 cut(s) 23, 186
Bst6I CTCTTC 1 cut(s) 101
BstKTI GATC 2 cut(s) 26, 189
BstMBI GATC 2 cut(s) 23, 186
BstMCI CGRYCG 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 70
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
CviQI GTAC 1 cut(s) 70
DpnI GATC 2 cut(s) 25, 188
DpnII GATC 2 cut(s) 23, 186
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco47I GGWCC 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 111
FaiI YATR 3 cut(s) 19, 21, 149
FauNDI CATATG 1 cut(s) 19
FspBI CTAG 1 cut(s) 117
HinfI GANTC 1 cut(s) 50
HphI GGTGA 3 cut(s) 149, 155, 161
Hpy188I TCNGA 2 cut(s) 28, 105
HpyAV CCTTC 5 cut(s) 84, 164, 170, 176, 182
Kzo9I GATC 2 cut(s) 23, 186
LpnPI CCDG 1 cut(s) 63
MaeI CTAG 1 cut(s) 117
MalI GATC 2 cut(s) 25, 188
MboI GATC 2 cut(s) 23, 186
MboII GAAGA 3 cut(s) 6, 108, 118
MluCI AATT 1 cut(s) 81
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 4 cut(s) 22, 25, 102, 124
NdeI CATATG 1 cut(s) 19
NdeII GATC 2 cut(s) 23, 186
Ple19I CGATCG 1 cut(s) 189
PleI GAGTC 1 cut(s) 44
PpsI GAGTC 1 cut(s) 44
PpuMI RGGWCCY 1 cut(s) 111
Psp5II RGGWCCY 1 cut(s) 111
PspPI GGNCC 1 cut(s) 111
PspPPI RGGWCCY 1 cut(s) 111
PvuI CGATCG 1 cut(s) 189
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
Sau3AI GATC 2 cut(s) 23, 186
Sau96I GGNCC 1 cut(s) 111
SchI GAGTC 1 cut(s) 44
SetI ASST 5 cut(s) 116, 122, 162, 168, 174
SgeI CNNG 6 cut(s) 18, 22, 86, 90, 129, 137
SinI GGWCC 1 cut(s) 111
Sse9I AATT 1 cut(s) 81
SspMI CTAG 1 cut(s) 117
TasI AATT 1 cut(s) 81
TspDTI ATGAA 1 cut(s) 6
VpaK11BI GGWCC 1 cut(s) 111
XapI RAATTY 1 cut(s) 81
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.