Rroxscaffold_2G00148860

Belongs to the enoyl-CoA hydratase isomerase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
86496821 .. 86497629
809 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00148860.1

Sequence Viewer

Length: 300 bp
ATGAAGAAGGGTGATGAAGCATTAAACATTGATAATTTTAAGGAGTTCTGCCCTAAACAACCAATGGAGAAATTAACTGGAACAAAAGCTTCTCAAGCTAGGAAATTTCAAGTGAGCTTGCAAGGTCACTACCCTGCCAGGAATAGAACTTCCCAGGATCCACATGAGGACATCAAAGCGATTTTGGCCAAGTTCAACAGTAATCCTGATTCTGAATCCCAACTGAAGCAGTTTTTACCTCAAATAACCTCATCATTTGGTGTAAATAAGCATCAGTTATTGAGACAGTTGAAGAAGTGA

Protein Analysis

99

Amino Acids

11.33

Weight (kDa)

9.76

Isoelectric Point (pI)

52.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022530)

Species Orthologous Gene IDs
pyrus_communis pycom02g04420 pycom02g04470 pycom15g17010
rosa_roxburghii Rroxscaffold_2G00148860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 152, 165
AcoI YGGCCR 1 cut(s) 186
AcsI RAATTY 1 cut(s) 104
AcuI CTGAAG 1 cut(s) 245
AgsI TTSAA 3 cut(s) 110, 196, 292
AjnI CCWGG 2 cut(s) 137, 153
AluBI AGCT 3 cut(s) 89, 98, 117
AluI AGCT 3 cut(s) 89, 98, 117
Alw26I GTCTC 1 cut(s) 277
AlwI GGATC 2 cut(s) 152, 165
AoxI GGCC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 23
BalI TGGCCA 1 cut(s) 188
BamHI GGATCC 1 cut(s) 157
BciT130I CCWGG 2 cut(s) 139, 155
BcoDI GTCTC 1 cut(s) 277
BfaI CTAG 1 cut(s) 99
Bme1390I CCNGG 2 cut(s) 139, 155
BmiI GGNNCC 1 cut(s) 159
BmrFI CCNGG 2 cut(s) 139, 155
BmsI GCATC 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 82
BseBI CCWGG 2 cut(s) 139, 155
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 82
BshFI GGCC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 277
BsnI GGCC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 157
BspANI GGCC 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 159
BspPI GGATC 2 cut(s) 152, 165
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 1 cut(s) 157
Bst2UI CCWGG 2 cut(s) 139, 155
Bst4CI ACNGT 2 cut(s) 200, 288
BstC8I GCNNGC 1 cut(s) 119
BstKTI GATC 1 cut(s) 160
BstMAI GTCTC 1 cut(s) 277
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 2 cut(s) 95, 185
BstNI CCWGG 2 cut(s) 139, 155
BstSCI CCNGG 2 cut(s) 137, 153
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BsuRI GGCC 1 cut(s) 188
Cac8I GCNNGC 1 cut(s) 119
CviAII CATG 1 cut(s) 164
CviJI RGCY 4 cut(s) 89, 98, 117, 188
CviKI_1 RGCY 4 cut(s) 89, 98, 117, 188
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
EaeI YGGCCR 1 cut(s) 186
Eco57I CTGAAG 1 cut(s) 245
EcoRII CCWGG 2 cut(s) 137, 153
FaeI CATG 1 cut(s) 167
FaiI YATR 1 cut(s) 165
FatI CATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 1 cut(s) 167
HindIII AAGCTT 1 cut(s) 87
HinfI GANTC 2 cut(s) 209, 215
HphI GGTGA 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 206
HpyCH4III ACNGT 2 cut(s) 200, 288
HpyCH4V TGCA 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 185
Hsp92II CATG 1 cut(s) 167
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 7 cut(s) 63, 124, 140, 147, 151, 167, 219
LweI GCATC 1 cut(s) 280
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 125
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 157
MlsI TGGCCA 1 cut(s) 188
MluCI AATT 3 cut(s) 34, 71, 104
MluNI TGGCCA 1 cut(s) 188
MnlI CCTC 3 cut(s) 160, 249, 259
Mox20I TGGCCA 1 cut(s) 188
MscI TGGCCA 1 cut(s) 188
MseI TTAA 3 cut(s) 23, 39, 74
Msp20I TGGCCA 1 cut(s) 188
MspR9I CCNGG 2 cut(s) 139, 155
MvaI CCWGG 2 cut(s) 139, 155
MwoI GCNNNNNNNGC 2 cut(s) 95, 185
NdeII GATC 1 cut(s) 157
NlaIII CATG 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 159
NmuCI GTSAC 1 cut(s) 125
PfeI GAWTC 2 cut(s) 209, 215
Psp6I CCWGG 2 cut(s) 137, 153
PspGI CCWGG 2 cut(s) 137, 153
PspN4I GGNNCC 1 cut(s) 159
PsuI RGATCY 1 cut(s) 157
SaqAI TTAA 3 cut(s) 23, 39, 74
Sau3AI GATC 1 cut(s) 157
ScrFI CCNGG 2 cut(s) 139, 155
SetI ASST 6 cut(s) 91, 100, 119, 127, 241, 251
SfaNI GCATC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 93
SmoI CTYRAG 1 cut(s) 93
Sse9I AATT 3 cut(s) 34, 71, 104
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 2 cut(s) 137, 153
TaaI ACNGT 2 cut(s) 200, 288
TasI AATT 3 cut(s) 34, 71, 104
TfiI GAWTC 2 cut(s) 209, 215
Tru1I TTAA 3 cut(s) 23, 39, 74
Tru9I TTAA 3 cut(s) 23, 39, 74
TseFI GTSAC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 17, 30
XapI RAATTY 1 cut(s) 104
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.