Rroxscaffold_2G00155290

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0020666
Physical Location & Seq
Reverse (-)
91689668 .. 91697190
7523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00155290.1

Sequence Viewer

Length: 540 bp
ATGTTGGAGCCACCCACAGAAGTTAATGAGATCCAATACCAGATGGCCCAATTTCCCATTTTTGCCCCTCAGAAAGCACATTCGTTGCATGTCCATTTCATAGAAGGCTGGGACCATTTTGGTAAACAGCCAAATACACTAGTGGAAGAAGAAGGCAAAGAAGTCATCGAAGATGAGAAAGTTCGATCCTTGGCCCGTGTTCTTCAAGTGGGAGTGGATCGGAACTGGCCTTTCCTCGTCGACTTTGCCATCACCGGGACTCTAATCACCAATGAAAGGCCCAAGTTCGAGTTGTTAAATAACAACTTCATCCCTACCAACTGTTCAGAAAAGCAAGGCTTCGTTCGTTACATTTTGGGGGAATTCAAGAAACAGAGCAAGAAGAAGTTTCGGATTCCCGTGATGGAGAACTATCAGCCCGATGAAGAGGTCGTCAAAGGAAGTACTAGCATCGTCTACATAGACATCAATCGTTGCACTAGGCAACGCCATGTGATTAAGGAGTTCTCGCCGGCTAGAGTTGACGCTCGGTTTGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

179

Amino Acids

20.88

Weight (kDa)

6.53

Isoelectric Point (pI)

39.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020666)

Species Orthologous Gene IDs
rosa_laevigata RLG00000015697
rosa_multiflora Rmu_sc0007908.1_g000003 Rmu_sc0020315.1_g000005
rosa_roxburghii Rroxscaffold_2G00155290
rosa_samantha Rh2CG011300 Rh2DG012200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 240, 456
AclWI GGATC 3 cut(s) 25, 180, 225
AcsI RAATTY 1 cut(s) 362
AfaI GTAC 1 cut(s) 445
AfiI CCNNNNNNNGG 2 cut(s) 255, 276
AgsI TTSAA 2 cut(s) 206, 367
AhlI ACTAGT 1 cut(s) 139
AlwI GGATC 3 cut(s) 25, 180, 225
AoxI GGCC 4 cut(s) 45, 192, 227, 278
ApoI RAATTY 1 cut(s) 362
ArsI GACNNNNNNTTYG 1 cut(s) 515
AspS9I GGNCC 4 cut(s) 46, 112, 193, 279
AsuC2I CCSGG 1 cut(s) 256
AsuHPI GGTGA 2 cut(s) 244, 259
AvaII GGWCC 1 cut(s) 112
BccI CCATC 3 cut(s) 37, 257, 397
BcnI CCSGG 1 cut(s) 256
BcuI ACTAGT 1 cut(s) 139
BfaI CTAG 4 cut(s) 140, 447, 480, 516
BmcAI AGTACT 1 cut(s) 445
Bme1390I CCNGG 1 cut(s) 256
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 4 cut(s) 46, 112, 193, 279
BmiI GGNNCC 2 cut(s) 9, 113
BmrFI CCNGG 1 cut(s) 256
BmsI GCATC 1 cut(s) 459
BpuMI CCSGG 1 cut(s) 256
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 2 cut(s) 255, 276
Bse118I RCCGGY 1 cut(s) 511
Bse1I ACTGG 1 cut(s) 230
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 309
BseLI CCNNNNNNNGG 2 cut(s) 255, 276
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 230
BseYI CCCAGC 1 cut(s) 108
BshFI GGCC 4 cut(s) 47, 194, 229, 280
BsiSI CCGG 2 cut(s) 255, 512
BslFI GGGAC 2 cut(s) 125, 271
BslI CCNNNNNNNGG 2 cut(s) 255, 276
BsmFI GGGAC 2 cut(s) 125, 271
BsnI GGCC 4 cut(s) 47, 194, 229, 280
Bsp143I GATC 3 cut(s) 30, 185, 217
BspANI GGCC 4 cut(s) 47, 194, 229, 280
BspCNI CTCAG 1 cut(s) 82
BspLI GGNNCC 2 cut(s) 9, 113
BspPI GGATC 3 cut(s) 25, 180, 225
BsrFI RCCGGY 1 cut(s) 511
BsrI ACTGG 1 cut(s) 230
BssAI RCCGGY 1 cut(s) 511
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 3 cut(s) 30, 185, 217
BssT1I CCWWGG 1 cut(s) 189
Bst4CI ACNGT 1 cut(s) 323
Bst6I CTCTTC 1 cut(s) 420
BstC8I GCNNGC 1 cut(s) 513
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 309
BstKTI GATC 3 cut(s) 33, 188, 220
BstMBI GATC 3 cut(s) 30, 185, 217
BstMWI GCNNNNNNNGC 1 cut(s) 533
BstNSI RCATGY 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 254
BstX2I RGATCY 1 cut(s) 30
BstYI RGATCY 1 cut(s) 30
BsuRI GGCC 4 cut(s) 47, 194, 229, 280
BtsCI GGATG 1 cut(s) 309
Cac8I GCNNGC 1 cut(s) 513
Cfr10I RCCGGY 1 cut(s) 511
Cfr13I GGNCC 4 cut(s) 46, 112, 193, 279
CseI GACGC 1 cut(s) 533
Csp6I GTAC 1 cut(s) 444
CviAII CATG 2 cut(s) 89, 491
CviQI GTAC 1 cut(s) 444
DdeI CTNAG 1 cut(s) 69
DpnI GATC 3 cut(s) 32, 187, 219
DpnII GATC 3 cut(s) 30, 185, 217
Eam1104I CTCTTC 1 cut(s) 420
EarI CTCTTC 1 cut(s) 420
Eco130I CCWWGG 1 cut(s) 189
Eco47I GGWCC 1 cut(s) 112
EcoRI GAATTC 1 cut(s) 362
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 2 cut(s) 92, 494
FaiI YATR 4 cut(s) 90, 101, 461, 492
FalI AAGNNNNNCTT 2 cut(s) 323, 355
FaqI GGGAC 2 cut(s) 125, 271
FatI CATG 2 cut(s) 88, 490
FblI GTMKAC 2 cut(s) 240, 456
FokI GGATG 1 cut(s) 296
FspBI CTAG 4 cut(s) 140, 447, 480, 516
GsaI CCCAGC 1 cut(s) 112
HaeIII GGCC 4 cut(s) 47, 194, 229, 280
HapII CCGG 2 cut(s) 255, 512
HgaI GACGC 1 cut(s) 533
Hin1II CATG 2 cut(s) 92, 494
HincII GTYRAC 2 cut(s) 241, 523
HindII GTYRAC 2 cut(s) 241, 523
HinfI GANTC 2 cut(s) 259, 394
HpaII CCGG 2 cut(s) 255, 512
HphI GGTGA 2 cut(s) 244, 259
Hpy166II GTNNAC 4 cut(s) 125, 241, 457, 523
Hpy188I TCNGA 4 cut(s) 72, 222, 328, 393
Hpy188III TCNNGA 1 cut(s) 367
Hpy8I GTNNAC 4 cut(s) 125, 241, 457, 523
Hpy99I CGWCG 1 cut(s) 242
HpyAV CCTTC 2 cut(s) 98, 146
HpyCH4III ACNGT 1 cut(s) 323
HpyCH4V TGCA 2 cut(s) 88, 477
HpyF10VI GCNNNNNNNGC 1 cut(s) 533
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 2 cut(s) 92, 494
KroI GCCGGC 1 cut(s) 511
KroNI GCCGGC 1 cut(s) 513
Kzo9I GATC 3 cut(s) 30, 185, 217
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 5 cut(s) 53, 94, 211, 268, 525
LweI GCATC 1 cut(s) 459
MaeI CTAG 4 cut(s) 140, 447, 480, 516
MaeIII GTNAC 1 cut(s) 347
MalI GATC 3 cut(s) 32, 187, 219
MboI GATC 3 cut(s) 30, 185, 217
MboII GAAGA 6 cut(s) 158, 161, 182, 194, 394, 437
MflI RGATCY 1 cut(s) 30
MluCI AATT 2 cut(s) 50, 362
MlyI GAGTC 1 cut(s) 253
MnlI CCTC 3 cut(s) 78, 245, 421
MroNI GCCGGC 1 cut(s) 511
MseI TTAA 3 cut(s) 24, 296, 498
MspI CCGG 2 cut(s) 255, 512
MspR9I CCNGG 1 cut(s) 256
MwoI GCNNNNNNNGC 1 cut(s) 533
NaeI GCCGGC 1 cut(s) 513
NciI CCSGG 1 cut(s) 256
NdeII GATC 3 cut(s) 30, 185, 217
NgoMIV GCCGGC 1 cut(s) 511
NlaIII CATG 2 cut(s) 92, 494
NlaIV GGNNCC 2 cut(s) 9, 113
NspI RCATGY 1 cut(s) 92
PdiI GCCGGC 1 cut(s) 513
PfeI GAWTC 1 cut(s) 394
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
PspFI CCCAGC 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 9, 113
PspPI GGNCC 4 cut(s) 46, 112, 193, 279
PsuI RGATCY 1 cut(s) 30
RsaI GTAC 1 cut(s) 445
RsaNI GTAC 1 cut(s) 444
SalI GTCGAC 1 cut(s) 239
SaqAI TTAA 3 cut(s) 24, 296, 498
Sau3AI GATC 3 cut(s) 30, 185, 217
Sau96I GGNCC 4 cut(s) 46, 112, 193, 279
ScaI AGTACT 1 cut(s) 445
SchI GAGTC 1 cut(s) 253
ScrFI CCNGG 1 cut(s) 256
SetI ASST 1 cut(s) 432
SfaNI GCATC 1 cut(s) 459
SinI GGWCC 1 cut(s) 112
SpeI ACTAGT 1 cut(s) 139
Sse9I AATT 2 cut(s) 50, 362
SspMI CTAG 4 cut(s) 140, 447, 480, 516
StyD4I CCNGG 1 cut(s) 254
StyI CCWWGG 1 cut(s) 189
TaaI ACNGT 1 cut(s) 323
TaqI TCGA 4 cut(s) 168, 184, 240, 288
TasI AATT 2 cut(s) 50, 362
TatI WGTACW 1 cut(s) 443
TfiI GAWTC 1 cut(s) 394
Tru1I TTAA 3 cut(s) 24, 296, 498
Tru9I TTAA 3 cut(s) 24, 296, 498
TspDTI ATGAA 4 cut(s) 88, 288, 298, 438
VpaK11BI GGWCC 1 cut(s) 112
XapI RAATTY 1 cut(s) 362
XceI RCATGY 1 cut(s) 92
XmiI GTMKAC 2 cut(s) 240, 456
XspI CTAG 4 cut(s) 140, 447, 480, 516
ZrmI AGTACT 1 cut(s) 445
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.