Rroxscaffold_3G00242910

3-beta hydroxysteroid dehydrogenase/isomerase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
35431966 .. 35439778
7813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00242910.1

Sequence Viewer

Length: 153 bp
ATGGAAGAGAGTGGAGAGAAAGAAACAATTTGTGTTATAGGTGCTGGAGGCTTTGTGGCAGCTCAGCTCGTCAAGTTGATGCTTTCTAAGGGATACCAAGTTCATGGCACCGTGAGAGACCCATTGGAATATAAAAAATTATTTAAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.51

Weight (kDa)

7.88

Isoelectric Point (pI)

2.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022573)

Species Orthologous Gene IDs
pyrus_communis pycom17g22640
rosa_multiflora Rmu_ssc0000141.1_g000001
rosa_roxburghii Rroxscaffold_3G00242910
rosa_samantha Rh2BG367800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 107
AloI GAACNNNNNNTCC 2 cut(s) 84, 116
AluBI AGCT 2 cut(s) 62, 67
AluI AGCT 2 cut(s) 62, 67
Alw26I GTCTC 1 cut(s) 111
ApeKI GCWGC 1 cut(s) 59
BanI GGYRCC 1 cut(s) 107
BbvI GCAGC 1 cut(s) 71
BciVI GTATCC 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 111
BfuI GTATCC 1 cut(s) 86
BisI GCNGC 1 cut(s) 60
BlpI GCTNAGC 1 cut(s) 63
BlsI GCNGC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 109
BmsI GCATC 1 cut(s) 69
BpmI CTGGAG 1 cut(s) 66
Bpu1102I GCTNAGC 1 cut(s) 63
BsaI GGTCTC 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 39, 69
BseMII CTCAG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 71
BshNI GGYRCC 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 111
Bso31I GGTCTC 1 cut(s) 111
Bsp1720I GCTNAGC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 107
BspTNI GGTCTC 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 2 cut(s) 63, 87
BstMAI GTCTC 1 cut(s) 111
BstV1I GCAGC 1 cut(s) 71
BstXI CCANNNNNNTGG 1 cut(s) 104
BsuI GTATCC 1 cut(s) 86
CviAII CATG 1 cut(s) 104
CviJI RGCY 3 cut(s) 51, 62, 67
CviKI_1 RGCY 3 cut(s) 51, 62, 67
DdeI CTNAG 2 cut(s) 63, 87
DraI TTTAAA 1 cut(s) 145
Eco31I GGTCTC 1 cut(s) 111
FaeI CATG 1 cut(s) 107
FaiI YATR 3 cut(s) 38, 105, 132
FatI CATG 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
GluI GCNGC 1 cut(s) 60
GsuI CTGGAG 1 cut(s) 66
Hin1II CATG 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 63, 87
Hsp92II CATG 1 cut(s) 107
LpnPI CCDG 1 cut(s) 30
Lsp1109I GCAGC 1 cut(s) 71
LweI GCATC 1 cut(s) 69
MboII GAAGA 1 cut(s) 17
MluCI AATT 2 cut(s) 27, 137
MnlI CCTC 1 cut(s) 41
MseI TTAA 1 cut(s) 144
NlaIII CATG 1 cut(s) 107
NlaIV GGNNCC 1 cut(s) 109
PkrI GCNGC 1 cut(s) 61
PspN4I GGNNCC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 144
SatI GCNGC 1 cut(s) 60
SetI ASST 3 cut(s) 43, 64, 69
SfaNI GCATC 1 cut(s) 69
SgeI CNNG 6 cut(s) 57, 80, 85, 110, 116, 124
Sse9I AATT 2 cut(s) 27, 137
TaaI ACNGT 1 cut(s) 112
TasI AATT 2 cut(s) 27, 137
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TseI GCWGC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.