Rroxscaffold_4G00278730

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0020481
Physical Location & Seq
Reverse (-)
1602929 .. 1605685
2757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00278730.1

Sequence Viewer

Length: 276 bp
ATGGAAATTGAAATTGTATCTGATATGAAATTGTTTAGGTGGAGGTGGAAACAAATTGGTGATTTCCCAAAGGGGGTCTGGAAAGCATTGTGGGGATTAAACTCATTAAAGTATCCAAATAAAGTGAAAATCTTTATGTGGAGAGCATGTTGTGGCTTCCTTCCTTGTGCTGCAGCCTTGTTCTATAGAAAGATTGGGTCTAGTGCATGCTGTGGGAGTTGTGGTTTTAGGGAAGAGACTGCTAATCATGTTGCAACTGTTGCTAAACATTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

91

Amino Acids

10.41

Weight (kDa)

9.37

Isoelectric Point (pI)

55.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RVT PF13966 26 - 86 1.6e-07 zinc-binding in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020481)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0329231
rosa_laevigata RLG00000029908
rosa_multiflora Rmu_sc0000156.1_g000010 Rmu_sc0014673.1_g000002
rosa_roxburghii Rroxscaffold_2G00140680 Rroxscaffold_4G00278730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 73
AgsI TTSAA 1 cut(s) 11
Alw26I GTCTC 1 cut(s) 230
ApeKI GCWGC 2 cut(s) 170, 173
AsuHPI GGTGA 1 cut(s) 71
BbvI GCAGC 2 cut(s) 157, 185
BciVI GTATCC 1 cut(s) 123
BcoDI GTCTC 1 cut(s) 230
BfaI CTAG 1 cut(s) 201
BfmI CTRYAG 2 cut(s) 171, 184
BfuI GTATCC 1 cut(s) 123
BisI GCNGC 2 cut(s) 171, 174
BlsI GCNGC 2 cut(s) 172, 175
BsaXI ACNNNNNCTCC 4 cut(s) 133, 163, 208, 238
Bsc4I CCNNNNNNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 73
BseXI GCAGC 2 cut(s) 157, 185
BslI CCNNNNNNNGG 1 cut(s) 73
BsmAI GTCTC 1 cut(s) 230
BspMAI CTGCAG 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 259
Bst6I CTCTTC 1 cut(s) 228
BstAPI GCANNNNNTGC 1 cut(s) 260
BstC8I GCNNGC 1 cut(s) 208
BstMAI GTCTC 1 cut(s) 230
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstNSI RCATGY 2 cut(s) 150, 210
BstSFI CTRYAG 2 cut(s) 171, 184
BstV1I GCAGC 2 cut(s) 157, 185
BsuI GTATCC 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 208
CviAII CATG 3 cut(s) 147, 207, 248
CviJI RGCY 2 cut(s) 156, 176
CviKI_1 RGCY 2 cut(s) 156, 176
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
FaeI CATG 3 cut(s) 150, 210, 251
FaiI YATR 6 cut(s) 26, 137, 148, 186, 208, 249
FatI CATG 3 cut(s) 146, 206, 247
Fnu4HI GCNGC 2 cut(s) 171, 174
Fsp4HI GCNGC 2 cut(s) 171, 174
FspBI CTAG 1 cut(s) 201
GluI GCNGC 2 cut(s) 171, 174
Hin1II CATG 3 cut(s) 150, 210, 251
HphI GGTGA 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 170
HpyCH4III ACNGT 1 cut(s) 259
HpyCH4V TGCA 3 cut(s) 173, 206, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
Hsp92II CATG 3 cut(s) 150, 210, 251
LpnPI CCDG 1 cut(s) 64
Lsp1109I GCAGC 2 cut(s) 157, 185
MaeI CTAG 1 cut(s) 201
MboII GAAGA 1 cut(s) 245
MluCI AATT 4 cut(s) 6, 12, 29, 54
MnlI CCTC 1 cut(s) 36
MseI TTAA 2 cut(s) 98, 107
MwoI GCNNNNNNNGC 1 cut(s) 260
NlaIII CATG 3 cut(s) 150, 210, 251
NspI RCATGY 2 cut(s) 150, 210
PaeI GCATGC 1 cut(s) 210
PkrI GCNGC 2 cut(s) 172, 175
PstI CTGCAG 1 cut(s) 175
SaqAI TTAA 2 cut(s) 98, 107
SatI GCNGC 2 cut(s) 171, 174
SetI ASST 2 cut(s) 41, 47
SfcI CTRYAG 2 cut(s) 171, 184
SgeI CNNG 7 cut(s) 91, 159, 177, 190, 213, 219, 260
SphI GCATGC 1 cut(s) 210
Sse9I AATT 4 cut(s) 6, 12, 29, 54
SspMI CTAG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 259
TasI AATT 4 cut(s) 6, 12, 29, 54
Tru1I TTAA 2 cut(s) 98, 107
Tru9I TTAA 2 cut(s) 98, 107
TseI GCWGC 2 cut(s) 170, 173
TspDTI ATGAA 1 cut(s) 41
XceI RCATGY 2 cut(s) 150, 210
XcmI CCANNNNNNNNNTGG 1 cut(s) 75
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.