Rroxscaffold_4G00280920

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
3363584 .. 3364716
1133 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280920.1

Sequence Viewer

Length: 255 bp
ATGACAAGATGTGGTGTTGCAAATCAGCGAATAAGGCATGATGTAAATGGTGATGCTTATGCGCGTGGATGCACTGTTATTGATGTTTGCAGTAACAAGGGGATTTCCTCTTTTTTACATGCAGCACAGTCGCACAGAGGAGAGCTACAAAAGGATATAAGTACTAGATCGATATCAAATTTTACAGAGTCGAGTTACTATAGTTCAACTTGTACTTGGAAAGGTCAGACTATTACAGCTGAAACGTTGGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.2

Weight (kDa)

8.45

Isoelectric Point (pI)

40.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 64
AclI AACGTT 1 cut(s) 245
AcsI RAATTY 1 cut(s) 178
AfaI GTAC 2 cut(s) 163, 214
AgsI TTSAA 1 cut(s) 207
AluBI AGCT 2 cut(s) 145, 239
AluI AGCT 2 cut(s) 145, 239
ApeKI GCWGC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 178
AspLEI GCGC 1 cut(s) 64
AsuHPI GGTGA 1 cut(s) 62
BbvI GCAGC 1 cut(s) 134
BcgI CGANNNNNNTGC 2 cut(s) 111, 145
BfaI CTAG 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 199
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
BmcAI AGTACT 1 cut(s) 163
BmsI GCATC 2 cut(s) 43, 59
Bsa29I ATCGAT 1 cut(s) 170
BsaBI GATNNNNATC 1 cut(s) 172
Bse8I GATNNNNATC 1 cut(s) 172
BseCI ATCGAT 1 cut(s) 170
BseGI GGATG 1 cut(s) 74
BseJI GATNNNNATC 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 134
Bsh1236I CGCG 1 cut(s) 64
BshVI ATCGAT 1 cut(s) 170
Bsp143I GATC 1 cut(s) 167
BspDI ATCGAT 1 cut(s) 170
BspFNI CGCG 1 cut(s) 64
BssMI GATC 1 cut(s) 167
Bst4CI ACNGT 2 cut(s) 76, 129
BstF5I GGATG 1 cut(s) 74
BstFNI CGCG 1 cut(s) 64
BstHHI GCGC 1 cut(s) 64
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNSI RCATGY 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 199
BstUI CGCG 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 134
Bsu15I ATCGAT 1 cut(s) 170
BsuTUI ATCGAT 1 cut(s) 170
BtsCI GGATG 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 72
CfoI GCGC 1 cut(s) 64
ClaI ATCGAT 1 cut(s) 170
Csp6I GTAC 2 cut(s) 162, 213
CviAII CATG 2 cut(s) 38, 119
CviJI RGCY 2 cut(s) 145, 239
CviKI_1 RGCY 2 cut(s) 145, 239
CviQI GTAC 2 cut(s) 162, 213
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Eco32I GATATC 1 cut(s) 174
EcoRV GATATC 1 cut(s) 174
FaeI CATG 2 cut(s) 41, 122
FaiI YATR 6 cut(s) 39, 60, 120, 158, 201, 253
FatI CATG 2 cut(s) 37, 118
Fnu4HI GCNGC 1 cut(s) 123
FokI GGATG 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 123
FspBI CTAG 1 cut(s) 165
GlaI GCGC 1 cut(s) 63
GluI GCNGC 1 cut(s) 123
HhaI GCGC 1 cut(s) 64
Hin1II CATG 2 cut(s) 41, 122
Hin6I GCGC 1 cut(s) 62
HinP1I GCGC 1 cut(s) 62
HinfI GANTC 1 cut(s) 188
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 228
HpyCH4III ACNGT 2 cut(s) 76, 129
HpyCH4IV ACGT 1 cut(s) 245
HpyCH4V TGCA 4 cut(s) 20, 72, 90, 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpySE526I ACGT 1 cut(s) 245
Hsp92II CATG 2 cut(s) 41, 122
HspAI GCGC 1 cut(s) 62
Kzo9I GATC 1 cut(s) 167
Lsp1109I GCAGC 1 cut(s) 134
LweI GCATC 2 cut(s) 43, 59
MaeI CTAG 1 cut(s) 165
MaeII ACGT 1 cut(s) 245
MaeIII GTNAC 2 cut(s) 92, 194
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MluCI AATT 1 cut(s) 178
MlyI GAGTC 1 cut(s) 197
MnlI CCTC 2 cut(s) 118, 131
MspA1I CMGCKG 1 cut(s) 239
MvnI CGCG 1 cut(s) 64
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 1 cut(s) 167
NlaIII CATG 2 cut(s) 41, 122
NspI RCATGY 1 cut(s) 122
PkrI GCNGC 1 cut(s) 124
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
Psp1406I AACGTT 1 cut(s) 245
PvuII CAGCTG 1 cut(s) 239
RsaI GTAC 2 cut(s) 163, 214
RsaNI GTAC 2 cut(s) 162, 213
SatI GCNGC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 167
ScaI AGTACT 1 cut(s) 163
SchI GAGTC 1 cut(s) 197
SetI ASST 4 cut(s) 147, 226, 241, 248
SfaNI GCATC 2 cut(s) 43, 59
SfcI CTRYAG 1 cut(s) 199
Sse9I AATT 1 cut(s) 178
SspMI CTAG 1 cut(s) 165
TaaI ACNGT 2 cut(s) 76, 129
TaiI ACGT 1 cut(s) 248
TaqI TCGA 2 cut(s) 170, 191
TasI AATT 1 cut(s) 178
TatI WGTACW 2 cut(s) 161, 212
TscAI CASTG 1 cut(s) 79
TseI GCWGC 1 cut(s) 122
TspRI CASTG 1 cut(s) 79
XapI RAATTY 1 cut(s) 178
XceI RCATGY 1 cut(s) 122
XspI CTAG 1 cut(s) 165
ZrmI AGTACT 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.