Rroxscaffold_6G00417260

Protein trichome birefringence-like 3

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
39021643 .. 39022769
1127 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00417260.1

Sequence Viewer

Length: 204 bp
ATGAAAGTTCCTGTTTCAGTCCTTAACATAACACAGATGTCAGATTACCGAGTTGACGCTCACACAAAAGTTTACACTGAGACTGGAGGCAAACTACAAACAGATGAGCAAAAGGCCGATGTGCTACACAACTCAGATTGTATACATTGGTGTCTGCCAGGAGTTCCGGATACATGGAATCAAATTTTTTTGGCAAATTTGTAG

Protein Analysis

67

Amino Acids

7.59

Weight (kDa)

5.32

Isoelectric Point (pI)

31.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PC-Esterase PF13839 1 - 65 3e-22 GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021279)

Species Orthologous Gene IDs
pyrus_communis pycom12g04860
rosa_chinensis RchiOBHm_Chr3g0462711
rosa_roxburghii Rroxscaffold_6G00417260
rosa_samantha Rh3BG120500 Rh4DG328900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 142
AccIII TCCGGA 1 cut(s) 166
AcsI RAATTY 2 cut(s) 183, 196
AjnI CCWGG 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 74
Aor13HI TCCGGA 1 cut(s) 166
AoxI GGCC 1 cut(s) 114
ApoI RAATTY 2 cut(s) 183, 196
BciT130I CCWGG 1 cut(s) 159
BciVI GTATCC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 74
BfuI GTATCC 1 cut(s) 163
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BpmI CTGGAG 1 cut(s) 105
BsaWI WCCGGW 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 88
BseAI TCCGGA 1 cut(s) 166
BseBI CCWGG 1 cut(s) 159
BseMII CTCAG 2 cut(s) 69, 147
BseNI ACTGG 1 cut(s) 88
BshFI GGCC 1 cut(s) 116
BsiSI CCGG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 116
Bsp13I TCCGGA 1 cut(s) 166
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 2 cut(s) 70, 146
BspEI TCCGGA 1 cut(s) 166
BsrI ACTGG 1 cut(s) 88
BssNAI GTATAC 1 cut(s) 143
Bst1107I GTATAC 1 cut(s) 143
Bst2UI CCWGG 1 cut(s) 159
BstDEI CTNAG 2 cut(s) 78, 133
BstMAI GTCTC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstZ17I GTATAC 1 cut(s) 143
BsuI GTATCC 1 cut(s) 163
BsuRI GGCC 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 75
CseI GACGC 1 cut(s) 65
CviAII CATG 1 cut(s) 174
CviJI RGCY 1 cut(s) 116
CviKI_1 RGCY 1 cut(s) 116
DdeI CTNAG 2 cut(s) 78, 133
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 1 cut(s) 177
FaiI YATR 3 cut(s) 29, 143, 175
FatI CATG 1 cut(s) 173
FblI GTMKAC 1 cut(s) 142
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 116
HapII CCGG 1 cut(s) 167
HgaI GACGC 1 cut(s) 65
Hin1II CATG 1 cut(s) 177
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 178
HpaII CCGG 1 cut(s) 167
Hpy166II GTNNAC 3 cut(s) 55, 73, 143
Hpy188I TCNGA 2 cut(s) 43, 136
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 3 cut(s) 55, 73, 143
HpyF3I CTNAG 2 cut(s) 78, 133
Hsp92II CATG 1 cut(s) 177
Kpn2I TCCGGA 1 cut(s) 166
LpnPI CCDG 5 cut(s) 24, 69, 144, 171, 180
MluCI AATT 2 cut(s) 183, 196
MnlI CCTC 1 cut(s) 80
MroI TCCGGA 1 cut(s) 166
MseI TTAA 1 cut(s) 24
MspI CCGG 1 cut(s) 167
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NlaIII CATG 1 cut(s) 177
PfeI GAWTC 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
SaqAI TTAA 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 159
SgeI CNNG 7 cut(s) 23, 62, 96, 170, 171, 179, 186
Sse9I AATT 2 cut(s) 183, 196
StyD4I CCNGG 1 cut(s) 157
TasI AATT 2 cut(s) 183, 196
TfiI GAWTC 1 cut(s) 178
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 82
XapI RAATTY 2 cut(s) 183, 196
XmiI GTMKAC 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.