Rorug03G0226300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0021756
Physical Location & Seq
Reverse (-)
20779163 .. 20779650
488 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0226300.1

Sequence Viewer

Length: 297 bp
ATGCAGCAACAAAAGGTGCTGTCATCCAGATTTCAAAGAATTTGGCATGTGAATGGGCAAAAGATAACATTCGAACAAACACTAGCACCATGGGCTGTCAACACTAGGGCAGCAGCAGTCGAACCAGATGAGCATCGTGATGATTTCAGAAGGCTAATAGCTCGAACTCCGATTCGTCGCCTTGCAGACCCTAATGATATATCATCTCTGGTGACATTTCTTTGCCTCCCAGCTGCTTCTTATATCAATGGACAAGTTGTTAATATTGATGGAGGATTTAGAGTTAGTGGCTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.12

Weight (kDa)

9.76

Isoelectric Point (pI)

40.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
adh_short_C2 PF13561 28 - 93 8.2e-11 Enoyl-(Acyl carrier protein) reductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021756)

Species Orthologous Gene IDs
rosa_rugosa Rorug03G0226300
rosa_samantha Rh3CG134800 Rh3CG357000 Rh3DG133900 Rh5DG463900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AgsI TTSAA 1 cut(s) 35
AluBI AGCT 2 cut(s) 161, 233
AluI AGCT 2 cut(s) 161, 233
ApeKI GCWGC 4 cut(s) 4, 110, 113, 233
ApoI RAATTY 1 cut(s) 39
AsuHPI GGTGA 1 cut(s) 223
AsuII TTCGAA 1 cut(s) 72
BbvI GCAGC 4 cut(s) 16, 122, 125, 220
BccI CCATC 1 cut(s) 263
BfaI CTAG 3 cut(s) 83, 105, 295
BisI GCNGC 4 cut(s) 5, 111, 114, 234
BlsI GCNGC 4 cut(s) 6, 112, 115, 235
BmsI GCATC 1 cut(s) 142
Bpu14I TTCGAA 1 cut(s) 72
BsaBI GATNNNNATC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 89
Bse8I GATNNNNATC 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 23
BseJI GATNNNNATC 1 cut(s) 132
BseXI GCAGC 4 cut(s) 16, 122, 125, 220
BseYI CCCAGC 1 cut(s) 229
Bsp119I TTCGAA 1 cut(s) 72
Bsp19I CCATGG 1 cut(s) 89
BspT104I TTCGAA 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 89
BstBI TTCGAA 1 cut(s) 72
BstDSI CCRYGG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 23
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 50
BstV1I GCAGC 4 cut(s) 16, 122, 125, 220
BtgI CCRYGG 1 cut(s) 89
BtsCI GGATG 1 cut(s) 23
CviAII CATG 2 cut(s) 47, 90
CviJI RGCY 5 cut(s) 95, 154, 161, 233, 291
CviKI_1 RGCY 5 cut(s) 95, 154, 161, 233, 291
Eco130I CCWWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 2 cut(s) 50, 93
FaiI YATR 4 cut(s) 48, 91, 200, 243
FatI CATG 2 cut(s) 46, 89
Fnu4HI GCNGC 4 cut(s) 5, 111, 114, 234
FokI GGATG 1 cut(s) 10
Fsp4HI GCNGC 4 cut(s) 5, 111, 114, 234
FspBI CTAG 3 cut(s) 83, 105, 295
GluI GCNGC 4 cut(s) 5, 111, 114, 234
GsaI CCCAGC 1 cut(s) 233
Hin1II CATG 2 cut(s) 50, 93
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
HinfI GANTC 1 cut(s) 172
HphI GGTGA 1 cut(s) 223
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 149, 171
Hpy188III TCNNGA 2 cut(s) 27, 137
Hpy8I GTNNAC 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 180
HpyAV CCTTC 1 cut(s) 144
HpyCH4V TGCA 2 cut(s) 4, 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Hsp92II CATG 2 cut(s) 50, 93
LpnPI CCDG 4 cut(s) 40, 138, 194, 243
Lsp1109I GCAGC 4 cut(s) 16, 122, 125, 220
LweI GCATC 1 cut(s) 142
MaeI CTAG 3 cut(s) 83, 105, 295
MaeIII GTNAC 1 cut(s) 211
MluCI AATT 1 cut(s) 39
MnlI CCTC 2 cut(s) 236, 266
MseI TTAA 1 cut(s) 261
MslI CAYNNNNRTG 2 cut(s) 51, 138
MspA1I CMGCKG 1 cut(s) 233
MwoI GCNNNNNNNGC 1 cut(s) 92
NcoI CCATGG 1 cut(s) 89
NlaIII CATG 2 cut(s) 50, 93
NmuCI GTSAC 1 cut(s) 211
NspI RCATGY 1 cut(s) 50
NspV TTCGAA 1 cut(s) 72
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 4 cut(s) 6, 112, 115, 235
PspFI CCCAGC 1 cut(s) 229
PvuII CAGCTG 1 cut(s) 233
RseI CAYNNNNRTG 2 cut(s) 51, 138
SaqAI TTAA 1 cut(s) 261
SatI GCNGC 4 cut(s) 5, 111, 114, 234
SetI ASST 3 cut(s) 18, 163, 235
SfaNI GCATC 1 cut(s) 142
SfuI TTCGAA 1 cut(s) 72
SmiMI CAYNNNNRTG 2 cut(s) 51, 138
Sse9I AATT 1 cut(s) 39
SspI AATATT 1 cut(s) 265
SspMI CTAG 3 cut(s) 83, 105, 295
StyI CCWWGG 1 cut(s) 89
TaqI TCGA 3 cut(s) 72, 120, 163
TasI AATT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TseFI GTSAC 1 cut(s) 211
TseI GCWGC 4 cut(s) 4, 110, 113, 233
Tsp45I GTSAC 1 cut(s) 211
XapI RAATTY 1 cut(s) 39
XceI RCATGY 1 cut(s) 50
XspI CTAG 3 cut(s) 83, 105, 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.