Rh5DG463900

Calcium-dependent protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0021756
Physical Location & Seq
Reverse (-)
73508144 .. 73527746
19603 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG463900.1

Sequence Viewer

Length: 198 bp
ATGAATCCAGACCCGAACGCACCCTCGGCCGGGTCCTCCAAGGCCGGCCTGAACCGAATCTGGCGCTCATTAGGCCACCCCTGGGTGCAAGTTGATGGTGTGGCTCCTGATAAGGCTCTTGATTCTGCAGTTCTAAGTCGCTTAAAGCAATTTTCAGCTATGAACAAGCTGAAGAAAATGGCTCTTAGGATTCGGTAA

Protein Analysis

65

Amino Acids

7.1

Weight (kDa)

11.04

Isoelectric Point (pI)

36.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021756)

Species Orthologous Gene IDs
rosa_rugosa Rorug03G0226300
rosa_samantha Rh3CG134800 Rh3CG357000 Rh3DG133900 Rh5DG463900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 27
AcuI CTGAAG 1 cut(s) 191
AfiI CCNNNNNNNGG 3 cut(s) 29, 30, 82
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 2 cut(s) 158, 169
AluI AGCT 2 cut(s) 158, 169
AoxI GGCC 4 cut(s) 27, 42, 46, 73
AspLEI GCGC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 33
AsuC2I CCSGG 1 cut(s) 31
AvaII GGWCC 1 cut(s) 33
BccI CCATC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 82
BcnI CCSGG 1 cut(s) 31
BfmI CTRYAG 1 cut(s) 126
BfoI RGCGCY 1 cut(s) 67
Bme1390I CCNGG 2 cut(s) 31, 82
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 33
BmiI GGNNCC 2 cut(s) 34, 105
BmrFI CCNGG 2 cut(s) 31, 82
BpuMI CCSGG 1 cut(s) 31
BsaJI CCNNGG 4 cut(s) 24, 39, 80, 81
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 30, 82
Bse118I RCCGGY 1 cut(s) 44
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 4 cut(s) 24, 39, 80, 81
BseLI CCNNNNNNNGG 3 cut(s) 29, 30, 82
BseX3I CGGCCG 1 cut(s) 27
Bsh1285I CGRYCG 1 cut(s) 30
BshFI GGCC 4 cut(s) 29, 44, 48, 75
BsiEI CGRYCG 1 cut(s) 30
BsiSI CCGG 2 cut(s) 30, 45
BslI CCNNNNNNNGG 3 cut(s) 29, 30, 82
BsnI GGCC 4 cut(s) 29, 44, 48, 75
BspANI GGCC 4 cut(s) 29, 44, 48, 75
BspLI GGNNCC 2 cut(s) 34, 105
BspMAI CTGCAG 1 cut(s) 130
BsrFI RCCGGY 1 cut(s) 44
BssAI RCCGGY 1 cut(s) 44
BssECI CCNNGG 4 cut(s) 24, 39, 80, 81
BssT1I CCWWGG 1 cut(s) 39
Bst2UI CCWGG 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 134, 185
BstH2I RGCGCY 1 cut(s) 67
BstHHI GCGC 1 cut(s) 66
BstMCI CGRYCG 1 cut(s) 30
BstMWI GCNNNNNNNGC 2 cut(s) 26, 72
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 2 cut(s) 29, 80
BstSFI CTRYAG 1 cut(s) 126
BstZI CGGCCG 1 cut(s) 27
BsuRI GGCC 4 cut(s) 29, 44, 48, 75
Cac8I GCNNGC 1 cut(s) 46
CfoI GCGC 1 cut(s) 66
Cfr10I RCCGGY 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 33
CviJI RGCY 9 cut(s) 29, 44, 48, 75, 104, 116, 158, 169, 182
CviKI_1 RGCY 9 cut(s) 29, 44, 48, 75, 104, 116, 158, 169, 182
DdeI CTNAG 2 cut(s) 134, 185
EaeI YGGCCR 1 cut(s) 27
EagI CGGCCG 1 cut(s) 27
EclXI CGGCCG 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 33
Eco52I CGGCCG 1 cut(s) 27
Eco57I CTGAAG 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 80
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaiI YATR 1 cut(s) 161
FseI GGCCGGCC 1 cut(s) 48
GlaI GCGC 1 cut(s) 65
HaeII RGCGCY 1 cut(s) 67
HaeIII GGCC 4 cut(s) 29, 44, 48, 75
HapII CCGG 2 cut(s) 30, 45
HhaI GCGC 1 cut(s) 66
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HinfI GANTC 4 cut(s) 4, 57, 122, 190
HpaII CCGG 2 cut(s) 30, 45
Hpy188III TCNNGA 3 cut(s) 8, 107, 119
HpyCH4V TGCA 2 cut(s) 88, 128
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 72
HpyF3I CTNAG 2 cut(s) 134, 185
HspAI GCGC 1 cut(s) 64
KroI GCCGGC 1 cut(s) 44
KroNI GCCGGC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 8 cut(s) 21, 43, 46, 58, 62, 67, 94, 120
MboII GAAGA 1 cut(s) 184
MluCI AATT 1 cut(s) 149
MnlI CCTC 2 cut(s) 34, 46
MroNI GCCGGC 1 cut(s) 44
MseI TTAA 1 cut(s) 143
MspI CCGG 2 cut(s) 30, 45
MspR9I CCNGG 2 cut(s) 31, 82
MvaI CCWGG 1 cut(s) 82
MwoI GCNNNNNNNGC 2 cut(s) 26, 72
NaeI GCCGGC 1 cut(s) 46
NciI CCSGG 1 cut(s) 31
NgoMIV GCCGGC 1 cut(s) 44
NlaIV GGNNCC 2 cut(s) 34, 105
NmeAIII GCCGAG 1 cut(s) 5
PasI CCCWGGG 1 cut(s) 81
PdiI GCCGGC 1 cut(s) 46
PfeI GAWTC 4 cut(s) 4, 57, 122, 190
PpuMI RGGWCCY 1 cut(s) 33
Psp5II RGGWCCY 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PspN4I GGNNCC 2 cut(s) 34, 105
PspPI GGNCC 1 cut(s) 33
PspPPI RGGWCCY 1 cut(s) 33
PstI CTGCAG 1 cut(s) 130
RigI GGCCGGCC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 33
ScrFI CCNGG 2 cut(s) 31, 82
SetI ASST 2 cut(s) 160, 171
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 33
Sse9I AATT 1 cut(s) 149
StyD4I CCNGG 2 cut(s) 29, 80
StyI CCWWGG 1 cut(s) 39
TasI AATT 1 cut(s) 149
TfiI GAWTC 4 cut(s) 4, 57, 122, 190
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TspDTI ATGAA 2 cut(s) 17, 176
VpaK11BI GGWCC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.